ID: 1185448561

View in Genome Browser
Species Human (GRCh38)
Location X:271233-271255
Sequence CCCAGGACACAGAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185448551_1185448561 -5 Left 1185448551 X:271215-271237 CCAGCCCACACCTGGCCGCCCAG No data
Right 1185448561 X:271233-271255 CCCAGGACACAGAGGGAGGAAGG No data
1185448544_1185448561 20 Left 1185448544 X:271190-271212 CCCACGTGATGTCCTCCCCTCGT No data
Right 1185448561 X:271233-271255 CCCAGGACACAGAGGGAGGAAGG No data
1185448554_1185448561 -10 Left 1185448554 X:271220-271242 CCACACCTGGCCGCCCAGGACAC No data
Right 1185448561 X:271233-271255 CCCAGGACACAGAGGGAGGAAGG No data
1185448553_1185448561 -9 Left 1185448553 X:271219-271241 CCCACACCTGGCCGCCCAGGACA No data
Right 1185448561 X:271233-271255 CCCAGGACACAGAGGGAGGAAGG No data
1185448545_1185448561 19 Left 1185448545 X:271191-271213 CCACGTGATGTCCTCCCCTCGTG No data
Right 1185448561 X:271233-271255 CCCAGGACACAGAGGGAGGAAGG No data
1185448547_1185448561 5 Left 1185448547 X:271205-271227 CCCCTCGTGTCCAGCCCACACCT No data
Right 1185448561 X:271233-271255 CCCAGGACACAGAGGGAGGAAGG No data
1185448548_1185448561 4 Left 1185448548 X:271206-271228 CCCTCGTGTCCAGCCCACACCTG No data
Right 1185448561 X:271233-271255 CCCAGGACACAGAGGGAGGAAGG No data
1185448543_1185448561 26 Left 1185448543 X:271184-271206 CCTCAGCCCACGTGATGTCCTCC No data
Right 1185448561 X:271233-271255 CCCAGGACACAGAGGGAGGAAGG No data
1185448542_1185448561 27 Left 1185448542 X:271183-271205 CCCTCAGCCCACGTGATGTCCTC No data
Right 1185448561 X:271233-271255 CCCAGGACACAGAGGGAGGAAGG No data
1185448549_1185448561 3 Left 1185448549 X:271207-271229 CCTCGTGTCCAGCCCACACCTGG No data
Right 1185448561 X:271233-271255 CCCAGGACACAGAGGGAGGAAGG No data
1185448546_1185448561 8 Left 1185448546 X:271202-271224 CCTCCCCTCGTGTCCAGCCCACA No data
Right 1185448561 X:271233-271255 CCCAGGACACAGAGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185448561 Original CRISPR CCCAGGACACAGAGGGAGGA AGG Intergenic
No off target data available for this crispr