ID: 1185449949

View in Genome Browser
Species Human (GRCh38)
Location X:276555-276577
Sequence GGTTCAGGGGGAGGGTCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185449927_1185449949 21 Left 1185449927 X:276511-276533 CCTTCTCCTCCTCCTGGGACCCT No data
Right 1185449949 X:276555-276577 GGTTCAGGGGGAGGGTCGCCTGG No data
1185449938_1185449949 1 Left 1185449938 X:276531-276553 CCTTAGCTGGGGGCACGGGCAGG No data
Right 1185449949 X:276555-276577 GGTTCAGGGGGAGGGTCGCCTGG No data
1185449931_1185449949 12 Left 1185449931 X:276520-276542 CCTCCTGGGACCCTTAGCTGGGG No data
Right 1185449949 X:276555-276577 GGTTCAGGGGGAGGGTCGCCTGG No data
1185449934_1185449949 9 Left 1185449934 X:276523-276545 CCTGGGACCCTTAGCTGGGGGCA No data
Right 1185449949 X:276555-276577 GGTTCAGGGGGAGGGTCGCCTGG No data
1185449928_1185449949 15 Left 1185449928 X:276517-276539 CCTCCTCCTGGGACCCTTAGCTG No data
Right 1185449949 X:276555-276577 GGTTCAGGGGGAGGGTCGCCTGG No data
1185449937_1185449949 2 Left 1185449937 X:276530-276552 CCCTTAGCTGGGGGCACGGGCAG No data
Right 1185449949 X:276555-276577 GGTTCAGGGGGAGGGTCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185449949 Original CRISPR GGTTCAGGGGGAGGGTCGCC TGG Intronic