ID: 1185450015

View in Genome Browser
Species Human (GRCh38)
Location X:276826-276848
Sequence GTGAATCAACGGAAGGACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185450015_1185450026 19 Left 1185450015 X:276826-276848 CCCCTGTCCTTCCGTTGATTCAC 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1185450026 X:276868-276890 TGCGTTGAATGTGCGCGTCACGG 0: 1
1: 0
2: 0
3: 0
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185450015 Original CRISPR GTGAATCAACGGAAGGACAG GGG (reversed) Intronic
904050864 1:27637447-27637469 GTGAATCAACCAAAGGACAAAGG + Intergenic
909299654 1:73996142-73996164 GTGAAAAAAAGGAAGGAGAGTGG + Intergenic
909929931 1:81485839-81485861 ATGAATCAAGTGAAGGACTGAGG + Intronic
914991182 1:152500983-152501005 GTGAAAGAAGGGAAGGATAGAGG - Intergenic
915583217 1:156828681-156828703 GTGAAGCAATGGAAGGAGAGTGG + Intronic
917074517 1:171190492-171190514 GTCAATCAAGAGGAGGACAGAGG - Intronic
919866750 1:201788453-201788475 GGGACTCACTGGAAGGACAGAGG - Exonic
924067967 1:240245790-240245812 GTGAAGCAACAGAAGGCCTGGGG - Intronic
1064468886 10:15614970-15614992 AAGGATCAAGGGAAGGACAGAGG + Intronic
1064735028 10:18373226-18373248 GTGAATGAATGAAAGGAGAGGGG - Intronic
1070504708 10:77103010-77103032 GTGAATGAACCGATGGAGAGGGG + Intronic
1072761690 10:98062066-98062088 GTGACTCCACAGAACGACAGAGG - Intergenic
1074522649 10:114239556-114239578 GGGACTCACCGGAAGGAGAGCGG - Exonic
1082856663 11:57814210-57814232 GTGAATGAAGGGAAGGAAGGAGG + Intronic
1083171555 11:60926535-60926557 GTCAATCATCAGAAGGACAAAGG - Intronic
1083664921 11:64269168-64269190 GTGGACCCATGGAAGGACAGGGG - Intergenic
1084549096 11:69830378-69830400 CTGAATTAACTGGAGGACAGTGG - Intergenic
1088455776 11:110031329-110031351 GTGAATCACCTGAAGGAGGGTGG - Intergenic
1090069782 11:123533802-123533824 GTGAATAAACTAAAGCACAGAGG + Intronic
1092588109 12:9920788-9920810 GTGAATTAATGGAAGTAAAGAGG - Intronic
1093055612 12:14553132-14553154 GTGGAACATGGGAAGGACAGGGG + Intronic
1093083616 12:14841986-14842008 GTGAGTCAAGGGTTGGACAGTGG + Intronic
1093518135 12:20015523-20015545 GTGTCTCACTGGAAGGACAGTGG - Intergenic
1093953814 12:25194189-25194211 GGGAAACAAGGGAAGGAGAGTGG - Intronic
1094257820 12:28454946-28454968 GTGTTTCCATGGAAGGACAGAGG + Intronic
1095131032 12:38542645-38542667 GTGGGTCAAAGAAAGGACAGTGG - Intergenic
1098396825 12:70028443-70028465 GTGCCTCATCGCAAGGACAGAGG + Intergenic
1100563150 12:95769249-95769271 GGGATGCAACAGAAGGACAGGGG + Intronic
1102346968 12:112166790-112166812 CTGAGTGAACGGAAGGACTGTGG + Intronic
1108289955 13:48949139-48949161 GTGTATGAACTGAAGGAAAGAGG + Intergenic
1108754503 13:53483614-53483636 GTGAGTCAAAGGAAGAACAAAGG - Intergenic
1112275150 13:98010868-98010890 GAGAATCAACTGAACGCCAGAGG - Intronic
1113904372 13:113812549-113812571 GAGAAGCCGCGGAAGGACAGCGG - Exonic
1121708280 14:96017589-96017611 GTGAAGGAGAGGAAGGACAGGGG - Intergenic
1122369934 14:101223999-101224021 GTCAGTCAACCGAAGAACAGAGG + Intergenic
1122698854 14:103573393-103573415 GCGAATCACCTGAAGGTCAGGGG - Intronic
1122820714 14:104343421-104343443 GTGAGTCCTCGGAGGGACAGAGG - Intergenic
1125674449 15:41494761-41494783 GTGAACCCTCGGAAGGAGAGAGG + Intronic
1126403001 15:48293583-48293605 ATAAATCAAAGGAAGGAAAGAGG - Intronic
1126683066 15:51222725-51222747 ATGAATGAACGGAAGGAGATAGG + Intronic
1129607010 15:77029942-77029964 GGGCATCAAGTGAAGGACAGAGG - Intronic
1134872782 16:17666877-17666899 GTGTAACAACAGAAGGAGAGGGG - Intergenic
1143995221 17:11000829-11000851 GTGAATCTACGGCAGGGCTGAGG + Intergenic
1146826734 17:36029614-36029636 GTGGATGAACAGATGGACAGAGG - Intergenic
1147261446 17:39211711-39211733 GAGAATTGACGGAATGACAGAGG + Exonic
1147914915 17:43880442-43880464 GTGAAACAAGAGAAGGAAAGTGG + Intronic
1159968354 18:74619053-74619075 GTGAATCTAAGCAAGAACAGTGG + Intronic
1160899141 19:1418410-1418432 ATGAAGCAGAGGAAGGACAGGGG - Intronic
1162792059 19:13068301-13068323 GGGAGGCAAAGGAAGGACAGAGG + Intronic
1163383662 19:16985765-16985787 GTGAATGAATGGAGGGAGAGAGG + Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
926756189 2:16238014-16238036 ATGAATCAACAGAAAGTCAGTGG - Intergenic
930595367 2:53381034-53381056 GTGAATCATTTGAAGAACAGAGG - Intergenic
933020215 2:77181465-77181487 TTGATTCAAAGGAAGGACACTGG + Intronic
938294138 2:130166819-130166841 CTGAATCAATGGAAGGCCTGTGG + Intronic
938462509 2:131507062-131507084 CTGAATCAATGGAAGGCCTGTGG - Intergenic
946378882 2:219331348-219331370 GTGCATGAGAGGAAGGACAGGGG + Intronic
947370852 2:229444165-229444187 GAGAATAGACGGAAGGAAAGTGG + Intronic
1170485726 20:16813970-16813992 TTGAATCAATGGAAACACAGAGG + Intergenic
1175778535 20:61667812-61667834 GTGAATGAATGCAAGGGCAGAGG + Intronic
1178901196 21:36600537-36600559 GTGGAACAAAGGAAGCACAGAGG - Intergenic
1181113444 22:20615904-20615926 CTGAATCAACAGAAGGCCTGTGG + Intergenic
1181167510 22:20991589-20991611 GTGAATCAATGCTGGGACAGGGG - Intronic
1181948886 22:26540151-26540173 ATGAAGCAATGGAAGCACAGGGG + Intronic
1183820595 22:40343045-40343067 GTGAAGCAGAGGAAGAACAGAGG + Intergenic
956166720 3:66402923-66402945 TTGAATGAAGGGAGGGACAGAGG - Intronic
962297687 3:134206760-134206782 GGGAATCAATGGAAGAACAATGG + Intronic
963667888 3:148212748-148212770 GTCAATCAAGGAAAGGCCAGGGG + Intergenic
966472656 3:180308862-180308884 GGGAATCAATGGAAAGAAAGAGG + Intergenic
967728159 3:192881310-192881332 GTGAATCACCAGGAGGACATAGG + Intronic
970287283 4:14531902-14531924 GTGAATCAAGGGAAAGCCACAGG + Intergenic
971950494 4:33339587-33339609 AGGTATCAACGGAAGGACATGGG - Intergenic
974821360 4:67070594-67070616 GTGAATACACAGAAAGACAGAGG + Intergenic
976339919 4:83935437-83935459 TTGAATCAGCAGAAGGACAAAGG - Intergenic
990598815 5:57336856-57336878 GTGCATCTACGGAAGGTCACAGG + Intergenic
991592101 5:68263998-68264020 GTTAATCATCAGATGGACAGAGG - Intronic
992141862 5:73805498-73805520 CTGTATCAACCAAAGGACAGTGG - Intronic
999013454 5:148069528-148069550 GTGAATCTATGGAAGTACTGAGG - Intronic
1002861004 6:1079487-1079509 GTAAAGCATCTGAAGGACAGAGG - Intergenic
1004126500 6:12879203-12879225 GTGAACCAAGGGAGAGACAGTGG + Intronic
1011008735 6:82678925-82678947 GTGTACCAATGGCAGGACAGTGG + Intergenic
1011534449 6:88360866-88360888 GAGATTCAAAGGAAGGAGAGAGG - Intergenic
1012065559 6:94545832-94545854 TTGAAGCAAGGCAAGGACAGGGG - Intergenic
1014791196 6:125674360-125674382 ATGAATCAATGGAAGGACCAAGG - Intergenic
1016630131 6:146219768-146219790 GTGAATTAATGGTAGGACAGGGG + Intronic
1022657179 7:32330355-32330377 TAGAATCAAAGGAAGAACAGAGG + Intergenic
1024118506 7:46214616-46214638 GACAACCAAAGGAAGGACAGAGG - Intergenic
1027361910 7:77417489-77417511 GTGAATAAAAGGAAGGCCACTGG + Intergenic
1030409980 7:109164238-109164260 GTGATTCAAGGGAAGGACAATGG + Intergenic
1030503883 7:110395351-110395373 GTGAGACAACGGGAAGACAGAGG - Intergenic
1036948273 8:13116138-13116160 GTGAAACAACACAAGGTCAGGGG - Intronic
1040601453 8:48888405-48888427 GTGAAAAAACAGAAGAACAGAGG - Intergenic
1044533542 8:93334701-93334723 GTCATTTAACGGAAGCACAGAGG - Intergenic
1045372176 8:101535408-101535430 GTGAATCCAAGGCAGGACAAAGG + Intronic
1045628175 8:104082230-104082252 GAGAATTAAAGGAAGGAGAGAGG + Intronic
1048909467 8:139120825-139120847 ATGGATCACCTGAAGGACAGAGG - Intergenic
1052794967 9:32915083-32915105 GTGAATCAATAAAAGAACAGAGG - Intergenic
1054735175 9:68743816-68743838 GAGAATCAATAGAAGGACAGGGG - Intronic
1061963110 9:133998273-133998295 GTGAATGGAGGGAAGGACGGCGG - Intergenic
1062132769 9:134908896-134908918 GGGAACCAAAGGAAGGCCAGAGG - Intronic
1185450015 X:276826-276848 GTGAATCAACGGAAGGACAGGGG - Intronic
1187950826 X:24468449-24468471 GTGATTCAACAGAAGTCCAGGGG - Intronic
1187996101 X:24928417-24928439 GTTAACCAACGGAAGGACTGAGG + Intronic
1189244557 X:39553533-39553555 TTGAATGAACGGAAAGACTGTGG - Intergenic
1193475511 X:81959852-81959874 GTATAACAAAGGAAGGACAGTGG + Intergenic
1194162700 X:90474105-90474127 GTGAAACAATGGAAGGTCACTGG + Intergenic
1196375569 X:115029127-115029149 CTGAATCAAAGGAATGGCAGAGG + Intergenic
1200508975 Y:4051841-4051863 GTGAAACAATGGAAGGTCACTGG + Intergenic