ID: 1185456073

View in Genome Browser
Species Human (GRCh38)
Location X:311489-311511
Sequence GTCCTGTACGTGGACACCAT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 50}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185456073_1185456082 27 Left 1185456073 X:311489-311511 CCGATGGTGTCCACGTACAGGAC 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1185456082 X:311539-311561 GTGGGCCGTGACGTCCAGCGTGG 0: 1
1: 0
2: 0
3: 9
4: 65
1185456073_1185456077 -8 Left 1185456073 X:311489-311511 CCGATGGTGTCCACGTACAGGAC 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1185456077 X:311504-311526 TACAGGACGGTCATGCGTGAGGG 0: 1
1: 0
2: 0
3: 4
4: 25
1185456073_1185456078 8 Left 1185456073 X:311489-311511 CCGATGGTGTCCACGTACAGGAC 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1185456078 X:311520-311542 GTGAGGGCAGCGTGCCCGCGTGG 0: 1
1: 0
2: 0
3: 8
4: 133
1185456073_1185456079 9 Left 1185456073 X:311489-311511 CCGATGGTGTCCACGTACAGGAC 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1185456079 X:311521-311543 TGAGGGCAGCGTGCCCGCGTGGG 0: 1
1: 0
2: 0
3: 9
4: 72
1185456073_1185456076 -9 Left 1185456073 X:311489-311511 CCGATGGTGTCCACGTACAGGAC 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1185456076 X:311503-311525 GTACAGGACGGTCATGCGTGAGG 0: 1
1: 0
2: 0
3: 2
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185456073 Original CRISPR GTCCTGTACGTGGACACCAT CGG (reversed) Exonic