ID: 1185456079

View in Genome Browser
Species Human (GRCh38)
Location X:311521-311543
Sequence TGAGGGCAGCGTGCCCGCGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185456073_1185456079 9 Left 1185456073 X:311489-311511 CCGATGGTGTCCACGTACAGGAC 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1185456079 X:311521-311543 TGAGGGCAGCGTGCCCGCGTGGG 0: 1
1: 0
2: 0
3: 9
4: 72
1185456075_1185456079 -1 Left 1185456075 X:311499-311521 CCACGTACAGGACGGTCATGCGT 0: 1
1: 0
2: 0
3: 1
4: 8
Right 1185456079 X:311521-311543 TGAGGGCAGCGTGCCCGCGTGGG 0: 1
1: 0
2: 0
3: 9
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185456079 Original CRISPR TGAGGGCAGCGTGCCCGCGT GGG Exonic