ID: 1185457891

View in Genome Browser
Species Human (GRCh38)
Location X:319682-319704
Sequence AGGCGGCGTCCAGGACCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185457891_1185457905 21 Left 1185457891 X:319682-319704 CCTGGGGGTCCTGGACGCCGCCT No data
Right 1185457905 X:319726-319748 GGGGGCTCGAGTCCCGCCCTGGG No data
1185457891_1185457899 3 Left 1185457891 X:319682-319704 CCTGGGGGTCCTGGACGCCGCCT No data
Right 1185457899 X:319708-319730 CATCCCCGCGTCTGCCTTGGGGG No data
1185457891_1185457898 2 Left 1185457891 X:319682-319704 CCTGGGGGTCCTGGACGCCGCCT No data
Right 1185457898 X:319707-319729 GCATCCCCGCGTCTGCCTTGGGG No data
1185457891_1185457904 20 Left 1185457891 X:319682-319704 CCTGGGGGTCCTGGACGCCGCCT No data
Right 1185457904 X:319725-319747 TGGGGGCTCGAGTCCCGCCCTGG No data
1185457891_1185457906 22 Left 1185457891 X:319682-319704 CCTGGGGGTCCTGGACGCCGCCT No data
Right 1185457906 X:319727-319749 GGGGCTCGAGTCCCGCCCTGGGG No data
1185457891_1185457896 0 Left 1185457891 X:319682-319704 CCTGGGGGTCCTGGACGCCGCCT No data
Right 1185457896 X:319705-319727 CGGCATCCCCGCGTCTGCCTTGG No data
1185457891_1185457907 23 Left 1185457891 X:319682-319704 CCTGGGGGTCCTGGACGCCGCCT No data
Right 1185457907 X:319728-319750 GGGCTCGAGTCCCGCCCTGGGGG No data
1185457891_1185457897 1 Left 1185457891 X:319682-319704 CCTGGGGGTCCTGGACGCCGCCT No data
Right 1185457897 X:319706-319728 GGCATCCCCGCGTCTGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185457891 Original CRISPR AGGCGGCGTCCAGGACCCCC AGG (reversed) Intergenic
No off target data available for this crispr