ID: 1185458182

View in Genome Browser
Species Human (GRCh38)
Location X:320688-320710
Sequence CCTCCAATCCAGGCGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185458182_1185458188 -2 Left 1185458182 X:320688-320710 CCCTGCAGCGCCTGGATTGGAGG No data
Right 1185458188 X:320709-320731 GGTGTGACAGGTGGCATTTTTGG No data
1185458182_1185458190 17 Left 1185458182 X:320688-320710 CCCTGCAGCGCCTGGATTGGAGG No data
Right 1185458190 X:320728-320750 TTGGCCCGAAGTCCCTAGGCAGG No data
1185458182_1185458195 25 Left 1185458182 X:320688-320710 CCCTGCAGCGCCTGGATTGGAGG No data
Right 1185458195 X:320736-320758 AAGTCCCTAGGCAGGACGGGTGG No data
1185458182_1185458194 22 Left 1185458182 X:320688-320710 CCCTGCAGCGCCTGGATTGGAGG No data
Right 1185458194 X:320733-320755 CCGAAGTCCCTAGGCAGGACGGG No data
1185458182_1185458192 21 Left 1185458182 X:320688-320710 CCCTGCAGCGCCTGGATTGGAGG No data
Right 1185458192 X:320732-320754 CCCGAAGTCCCTAGGCAGGACGG No data
1185458182_1185458189 13 Left 1185458182 X:320688-320710 CCCTGCAGCGCCTGGATTGGAGG No data
Right 1185458189 X:320724-320746 ATTTTTGGCCCGAAGTCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185458182 Original CRISPR CCTCCAATCCAGGCGCTGCA GGG (reversed) Intergenic
No off target data available for this crispr