ID: 1185460665

View in Genome Browser
Species Human (GRCh38)
Location X:331572-331594
Sequence GCGGCCCGTGGGCACCGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185460661_1185460665 -7 Left 1185460661 X:331556-331578 CCTCGGCCTGGGCAGGGCGGCCC No data
Right 1185460665 X:331572-331594 GCGGCCCGTGGGCACCGTGCTGG No data
1185460660_1185460665 -6 Left 1185460660 X:331555-331577 CCCTCGGCCTGGGCAGGGCGGCC No data
Right 1185460665 X:331572-331594 GCGGCCCGTGGGCACCGTGCTGG No data
1185460656_1185460665 -1 Left 1185460656 X:331550-331572 CCGACCCCTCGGCCTGGGCAGGG No data
Right 1185460665 X:331572-331594 GCGGCCCGTGGGCACCGTGCTGG No data
1185460659_1185460665 -5 Left 1185460659 X:331554-331576 CCCCTCGGCCTGGGCAGGGCGGC No data
Right 1185460665 X:331572-331594 GCGGCCCGTGGGCACCGTGCTGG No data
1185460651_1185460665 10 Left 1185460651 X:331539-331561 CCGTGTGGGGTCCGACCCCTCGG No data
Right 1185460665 X:331572-331594 GCGGCCCGTGGGCACCGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185460665 Original CRISPR GCGGCCCGTGGGCACCGTGC TGG Intergenic
No off target data available for this crispr