ID: 1185464458

View in Genome Browser
Species Human (GRCh38)
Location X:346406-346428
Sequence CCTGCGGGAGGCGCCGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 285}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185464448_1185464458 8 Left 1185464448 X:346375-346397 CCAGGGCACAGGCGGGGGCAGAG 0: 1
1: 1
2: 3
3: 60
4: 639
Right 1185464458 X:346406-346428 CCTGCGGGAGGCGCCGCCCCAGG 0: 1
1: 0
2: 5
3: 39
4: 285
1185464441_1185464458 21 Left 1185464441 X:346362-346384 CCGCACGGGGCCGCCAGGGCACA 0: 1
1: 0
2: 0
3: 10
4: 136
Right 1185464458 X:346406-346428 CCTGCGGGAGGCGCCGCCCCAGG 0: 1
1: 0
2: 5
3: 39
4: 285
1185464447_1185464458 11 Left 1185464447 X:346372-346394 CCGCCAGGGCACAGGCGGGGGCA 0: 1
1: 0
2: 1
3: 27
4: 352
Right 1185464458 X:346406-346428 CCTGCGGGAGGCGCCGCCCCAGG 0: 1
1: 0
2: 5
3: 39
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185464458 Original CRISPR CCTGCGGGAGGCGCCGCCCC AGG Intronic
900203177 1:1420306-1420328 CCTGCTGGAGGCTCCGGGCCCGG - Exonic
900604886 1:3519511-3519533 CCTGGGGGAGGCCCCGACCCAGG + Intronic
903069201 1:20718157-20718179 CTTGCGGGAAGCGCCAGCCCTGG + Intergenic
903233765 1:21937011-21937033 CCGGCGGGCGCCGCCGTCCCGGG + Intronic
903462700 1:23530624-23530646 GCTGCGGGAGGCGCCGTCTGCGG + Exonic
904300547 1:29550799-29550821 GCTGGGGGAGGGGCCGGCCCCGG - Intergenic
904339367 1:29824209-29824231 CCTGCTGGAGGGGCAGCTCCAGG + Intergenic
904813753 1:33180895-33180917 CTTGCTGGCGGCCCCGCCCCAGG + Intronic
905866956 1:41381862-41381884 GCTGCGGCAGGCACCGGCCCCGG - Exonic
906418701 1:45644060-45644082 CCTGCTAGAGGCCCTGCCCCTGG - Intronic
906637030 1:47416576-47416598 CCAGCGTGAGGCGGCGGCCCGGG - Exonic
908112636 1:60912247-60912269 CCTCAGAGAGGCTCCGCCCCAGG - Intronic
908572118 1:65420803-65420825 CGCGCGGAAGGCGCAGCCCCAGG - Intronic
911002519 1:93180647-93180669 ACTGCGTGAGGCGCCGCCGAAGG - Exonic
912142448 1:106747909-106747931 CAGGCGTGAGCCGCCGCCCCCGG + Intergenic
912385419 1:109268944-109268966 CCTGCGTGGGGAGCAGCCCCCGG + Exonic
912955609 1:114152818-114152840 CCTGCGCGGGACGCAGCCCCAGG - Exonic
916179186 1:162069660-162069682 CCGGCGGGAGGAGCCGGCCTGGG + Intergenic
916536745 1:165710484-165710506 CATGCATGAGGCACCGCCCCCGG - Intergenic
917974280 1:180229479-180229501 GCGGCGGGCGGCGCCGGCCCGGG - Intergenic
920878471 1:209858913-209858935 CCGGCTGGCGCCGCCGCCCCGGG - Intergenic
921254862 1:213330020-213330042 CCTGCGGGAGGCCCTCCACCAGG - Intergenic
921909200 1:220528702-220528724 CCTGCGGGAGCCGCTCGCCCCGG + Exonic
922250659 1:223846029-223846051 CCTGGGGGAGGGGCGGCCGCGGG + Intergenic
922739307 1:228006687-228006709 CCTGCGGATCGCGCGGCCCCGGG + Intergenic
922956172 1:229602513-229602535 ACTGCGGGAGGAGCTGCCACTGG + Exonic
1066599039 10:37084302-37084324 CCCGCGGGAGCCACCGCGCCTGG - Intergenic
1067852396 10:49762125-49762147 GCTGCGGGCAGCGGCGCCCCAGG + Intronic
1067937674 10:50624846-50624868 CCCGCGGGAGGCACGGCCTCGGG - Intronic
1070129675 10:73647761-73647783 CCTGCAGGAGGCCCGGCGCCGGG - Exonic
1070162570 10:73874683-73874705 GCGGCGGGAGGCCCCTCCCCGGG - Intergenic
1071086976 10:81875765-81875787 CCTGGAGGAGGCGGCACCCCCGG - Exonic
1072409071 10:95183876-95183898 CCTGCCGCCGCCGCCGCCCCGGG + Intergenic
1072555748 10:96512866-96512888 CCTCCAGGAAGCGGCGCCCCAGG - Intronic
1072710667 10:97713891-97713913 CCCGCGCCAGCCGCCGCCCCAGG + Exonic
1074772285 10:116742125-116742147 CCCGCAGGAGGCGCCACCCGAGG + Intronic
1074843288 10:117375460-117375482 CCTGAGGGAGGCGCCGGTCCCGG - Exonic
1076096806 10:127739089-127739111 CCTGCTGGCCGAGCCGCCCCCGG - Exonic
1076907883 10:133372618-133372640 CCTGCGGGAGGCCCGGCGGCTGG - Intronic
1077441177 11:2569992-2570014 CCTGCGGTAGGGGCAGCCTCTGG - Intronic
1080456847 11:32426843-32426865 CCGGAGCGAGGCGCAGCCCCAGG - Intronic
1083024313 11:59537065-59537087 CCGGCGGGAGCCACCGCTCCCGG + Intergenic
1083571250 11:63763285-63763307 CCAGCGGGGGGCGCGGCCGCGGG + Exonic
1084018184 11:66399502-66399524 CATGCGTGAGCCGCCGCGCCCGG + Intergenic
1084129175 11:67119735-67119757 CCTGCGGCCGGGGCCGGCCCGGG + Exonic
1084658990 11:70536140-70536162 TCTGCTGGAGGCACCGACCCAGG + Intronic
1084948995 11:72654436-72654458 CCTGGGGGAGGCTCCTCCGCCGG + Intronic
1084978083 11:72814250-72814272 CCTCCGGGAGGAGCCGCCTCCGG - Intergenic
1085674453 11:78502711-78502733 CAGGCGTGAGGCGCCGCGCCTGG - Intronic
1088579207 11:111299577-111299599 CCTTCGGTAGGGGCCGCCCCGGG - Exonic
1089533953 11:119149481-119149503 CCGGCGGGAGGGGCCGGCCTGGG + Intronic
1091923020 12:4320992-4321014 GGTGCGGGAGGCCCCGCCCGCGG - Intergenic
1094082874 12:26556799-26556821 CATGCGTGAGGCACCGCACCTGG - Intronic
1094536087 12:31324177-31324199 CCTGCGGGAGGCGCCGGGCCGGG - Intronic
1094536094 12:31324193-31324215 CGTGCGGGAGGCGCGGCCTGCGG - Intronic
1094671437 12:32573370-32573392 CAGGCGTGAGCCGCCGCCCCTGG + Intronic
1096489774 12:52007143-52007165 CCTGCCGCAGCCGCCACCCCTGG + Exonic
1096647648 12:53047352-53047374 CCTGCGGGGGGCGCCCGGCCGGG - Intronic
1100509525 12:95255706-95255728 CAGGCGGGAGCCACCGCCCCCGG + Intronic
1104069617 12:125333081-125333103 ACTGCGGGAGGCGCTGTCCCAGG + Intronic
1105034327 12:132907985-132908007 CAGGCGGGAGCCGCCGCGCCCGG + Intronic
1105049755 12:133037757-133037779 CTTTCCGGAGGCGCCGCTCCTGG + Exonic
1105440879 13:20414929-20414951 CCCGCGGAATCCGCCGCCCCAGG + Intronic
1107060543 13:36155106-36155128 CCGGGGGAAGGCGCCGCCGCAGG - Intergenic
1112570463 13:100588822-100588844 CCTGCAGGGGGCGCCGCCGGGGG - Intronic
1112580786 13:100674860-100674882 GCTGCGGGAGGCGCGGCGCGGGG - Intronic
1113833287 13:113313581-113313603 CCTCCAGGAGGCCACGCCCCAGG - Intronic
1113833350 13:113313821-113313843 CCTCCAGGAGGCCACGCCCCAGG - Intronic
1113833389 13:113313965-113313987 CCTCCAGGAGGCCACGCCCCAGG - Intronic
1113833415 13:113314061-113314083 CCTCCAGGAGGCCACGCCCCAGG - Intronic
1113833429 13:113314109-113314131 CCTCCGGGAGGCCACGCCCCAGG - Intronic
1113833454 13:113314205-113314227 CCTCCAGGAGGCCACGCCCCAGG - Intronic
1113833467 13:113314253-113314275 CCTCCGGGAGGCCACGCCCCAGG - Intronic
1113833480 13:113314301-113314323 CCTCCAGGAGGCCACGCCCCAGG - Intronic
1113833496 13:113314349-113314371 CCTCCAGGAGGCCCCGCCCCAGG - Intronic
1113833522 13:113314445-113314467 CCTCCAGGAGGCCACGCCCCAGG - Intronic
1113833547 13:113314541-113314563 CCTCCAGGAGGCCACGCCCCAGG - Intronic
1113833572 13:113314637-113314659 CCTCCAGGAGGCCACGCCCCAGG - Intronic
1113833597 13:113314733-113314755 CCTCCAGGAGGCCACGCCCCAGG - Intronic
1113833622 13:113314829-113314851 CCTCCAGGAGGCCACGCCCCAGG - Intronic
1113833671 13:113315020-113315042 CCTCCAGGAGGCCACGCCCCAGG - Intronic
1113833695 13:113315116-113315138 CCTCCAGGAGGCCACGCCCCAGG - Intronic
1113833708 13:113315164-113315186 CCTCCGGGAGGCCACGCCCCAGG - Intronic
1113833722 13:113315212-113315234 CCTCCAGGAGGCCACGCCCCAGG - Intronic
1113833737 13:113315260-113315282 CCTCCAGGAGGCCCCGCCCCAGG - Intronic
1115727663 14:36234880-36234902 CCAGTGGGAGGGGCCACCCCAGG + Intergenic
1116152137 14:41154502-41154524 CCGGCCGGAGCCGCCGGCCCGGG - Intergenic
1119539302 14:75428218-75428240 GCGGGGGGAGGCGGCGCCCCCGG - Intronic
1121587446 14:95072019-95072041 TCTGCTGGAGGCGGGGCCCCGGG + Intergenic
1121828892 14:97033272-97033294 GCTGCGGGATCCGCCGCCCCGGG + Intergenic
1122408347 14:101513436-101513458 CCTGCAGGATGCGCCTCTCCCGG + Intergenic
1122913401 14:104844598-104844620 CCTGCTGGAGGCCCAGGCCCTGG + Intergenic
1126406820 15:48331170-48331192 GCTGCGGGCGGTGCCGCCCCAGG + Intronic
1130013459 15:80170119-80170141 CCTGGGGGAGGCAGCGCTCCGGG + Intronic
1132618618 16:854228-854250 CCTGTGGGCGGCACAGCCCCAGG + Exonic
1132691489 16:1183627-1183649 CCTGAGTGCGGCGCCTCCCCCGG - Intronic
1132903145 16:2269013-2269035 CCTGCCAGAGGCGCCACCTCTGG - Intergenic
1133559217 16:6934806-6934828 CCTGCAGGAGCCACCGCACCTGG - Intronic
1134629172 16:15744778-15744800 CAGGCGTGAGCCGCCGCCCCCGG + Intronic
1136186803 16:28593144-28593166 CCTGCTGGAGGGGCCGCCCAGGG + Intronic
1139433775 16:66925020-66925042 CCTGCAGGCGGCGCTGACCCCGG - Exonic
1139512780 16:67436856-67436878 CCTGCAGGAAGCGGCGCCGCAGG - Exonic
1139890900 16:70252765-70252787 CCTGCAGGAGGCGCTGCAGCTGG - Exonic
1141132238 16:81444593-81444615 CCGACGGGAGGGGCAGCCCCTGG - Intergenic
1142213716 16:88820922-88820944 CCAGCTGGAAGCGCCGTCCCAGG - Intronic
1142438391 16:90077522-90077544 CCTGGGGAAGGTCCCGCCCCTGG + Intronic
1142864185 17:2780326-2780348 CAGGCGGGAGCCGCCGCCTCTGG + Intronic
1142897617 17:2992041-2992063 CCGGCGTGAGCCGCCGCGCCTGG + Intronic
1142974577 17:3636017-3636039 CCTGGAGGCGGCGCGGCCCCGGG + Intronic
1144515942 17:15917647-15917669 CCAGCGGCAGGGGCCTCCCCAGG + Intergenic
1145041336 17:19580043-19580065 CCTGCGGGGTGCGCTGCCCCCGG + Intergenic
1145063987 17:19749661-19749683 CCTCCGTGAGCCCCCGCCCCAGG - Intergenic
1145941257 17:28744415-28744437 CCTGCGGGGGGGGCCTCCCTCGG - Intronic
1146062038 17:29612722-29612744 CCAGCGGGAGGCGGCGACCCGGG + Exonic
1146736468 17:35242997-35243019 CCTGCGCGATGTCCCGCCCCGGG + Intergenic
1147044407 17:37742757-37742779 CCTGCGGGTGTCGGCGACCCGGG + Intronic
1147312815 17:39605256-39605278 CCTGGGGGAAGCGAGGCCCCTGG + Exonic
1147811243 17:43171269-43171291 CCTCCGGCAGGCGCCCCCCGGGG + Intronic
1148090348 17:45019438-45019460 CCCGCGGGAGGCAGCGCCCGAGG + Intergenic
1148125004 17:45231893-45231915 CCTGCCGTAGGCCCCGCCCTGGG - Intronic
1148151055 17:45396635-45396657 CCTGCGGGGGGCGGGGACCCGGG - Intronic
1148491270 17:48025299-48025321 ACTGCGGGAAGCCCCGCCCCAGG - Intergenic
1148788827 17:50161558-50161580 CCTGCGGAGCGCGCCGCCCCGGG - Intergenic
1150225679 17:63523308-63523330 GCTCCGGTGGGCGCCGCCCCCGG - Intergenic
1150702874 17:67462977-67462999 CAGGCGTGAGCCGCCGCCCCCGG + Intronic
1151224878 17:72640597-72640619 CCTGCGGGCTGGGCCTCCCCGGG - Intergenic
1151681058 17:75623052-75623074 CAGGCGGGAGCCGCCGCGCCCGG - Intergenic
1151957392 17:77387203-77387225 TCTGCGGGAGGCTCCGGCCCAGG + Intronic
1152331945 17:79678576-79678598 CCTGCGGCTGCCGCCTCCCCGGG + Intergenic
1152624708 17:81382984-81383006 CCTGGGGGAGGGGCTGCCCCAGG - Intergenic
1152735745 17:81996044-81996066 CCTGATGGTGGCGCTGCCCCCGG - Exonic
1152782385 17:82232034-82232056 ACTGAGGGAGGCCCCTCCCCCGG + Intronic
1152791821 17:82284180-82284202 CAGGCGGGAGCCGCCGCGCCCGG - Intergenic
1153296010 18:3547226-3547248 CTTGCTGCAGGCTCCGCCCCCGG - Intronic
1154274619 18:12948245-12948267 CTTGCGGGCGGGGCCGACCCCGG + Intronic
1154501445 18:14999735-14999757 CCTGCCGGAGCCACCGCCCCTGG - Intergenic
1157338270 18:46756842-46756864 TCGGCGGGAGGGGCCGCCTCCGG - Exonic
1157498455 18:48172684-48172706 CCTGAGGGAGGGGCCGCCCAAGG - Intronic
1159040653 18:63320322-63320344 CCGGCGGGACGCGCCACTCCCGG - Intergenic
1160017409 18:75155200-75155222 CCTGCGGGAGGCCTAGCCCGGGG + Intergenic
1160559582 18:79747677-79747699 CCTGCAGGAGGCGCTGCGCATGG - Intronic
1160562739 18:79770052-79770074 CCTGTGGGAGCCGCCTCACCTGG - Intergenic
1160791493 19:925690-925712 GCCGCGGGAGGCCCCGCCCCCGG - Intergenic
1160858050 19:1226249-1226271 TCTGCGGGAGGCTCAGCCCCGGG + Intronic
1160983862 19:1828539-1828561 CCTGGGGGAGGAGCCGCGCCCGG - Exonic
1161077232 19:2291713-2291735 GCTGCCCGCGGCGCCGCCCCCGG - Exonic
1161102538 19:2428380-2428402 GCTGCAGGCGGCGACGCCCCAGG + Exonic
1161686589 19:5705737-5705759 CCTGAGGGCTGGGCCGCCCCGGG + Intronic
1161691836 19:5740002-5740024 CATGCGTGAGGCACCGCACCTGG - Intronic
1161707266 19:5828026-5828048 CCCGCCGCAGGCGCCGCCGCTGG - Exonic
1161802688 19:6424649-6424671 CCGGCGGGCGGCGGCGGCCCGGG + Exonic
1162019571 19:7862557-7862579 CCTGCCCGTGGCACCGCCCCCGG + Intronic
1162042789 19:7980532-7980554 CCTGCTGGAGGTGCTGCCCCTGG + Intronic
1162426917 19:10602556-10602578 CCTACGGTAGGAGCCGCCTCCGG + Intronic
1162435374 19:10654783-10654805 CCCGCGCGTGGCGCCGCCGCCGG - Intronic
1162733747 19:12734399-12734421 GCGGCAGGAGGAGCCGCCCCCGG - Exonic
1163416970 19:17192775-17192797 CCTGCAGGAGACGCTGCACCGGG + Exonic
1163654126 19:18535802-18535824 CCTGAGAGAGGAGCCGGCCCAGG + Intronic
1163804161 19:19386042-19386064 CCTGAGGGAGTCGCCTCCGCGGG + Exonic
1165434908 19:35790320-35790342 ACTGCGGGAGGCCCCGGCCCAGG - Intergenic
1165494204 19:36142247-36142269 CCCGTTGGAGGCCCCGCCCCTGG + Intronic
1165648638 19:37467222-37467244 CCTCTGGGAAGCGTCGCCCCTGG - Exonic
1166983887 19:46648741-46648763 CCTGCGGGAGGCGTCGGCGGGGG - Exonic
1167277858 19:48549854-48549876 CCTGCAGTAGGAGCCTCCCCTGG + Intergenic
1167376328 19:49114326-49114348 GCTGCGCGAGGCCACGCCCCGGG - Intronic
1168354952 19:55695141-55695163 CCTGCAGGAGGCCCAGCCACTGG + Exonic
1168403998 19:56101343-56101365 CCTGCGCTTGGCGCCGCCTCTGG - Intronic
1168676810 19:58284569-58284591 CAGGCGGGAGCCGCCGCGCCTGG - Intronic
925912704 2:8583766-8583788 CCTGCTGCAGGCGCCGGCGCGGG - Intergenic
928420155 2:31132087-31132109 CCTGCAGGAGGCCCTGTCCCAGG - Intronic
929133593 2:38602482-38602504 CCGCCGGGAAGCGACGCCCCGGG - Exonic
929133744 2:38603045-38603067 CCTGCGGGAAGCGCCCCCCCCGG + Intronic
929775529 2:44928933-44928955 GCTTCGGGAAGCGCCGCGCCCGG + Intergenic
932779916 2:74553623-74553645 CCTCCGGGAGGCGCTGCCCCTGG - Intronic
933655102 2:84880731-84880753 CCTGCGGGCTGCGCCCCCGCGGG + Intronic
933751098 2:85602516-85602538 CCTGCGGCCGGCGACCCCCCAGG + Intronic
935059275 2:99593702-99593724 CCTGCGAGAAGCGCCGCACGCGG - Exonic
938462948 2:131509772-131509794 CCTGCGGGAGGAGCGGGCCCGGG - Intergenic
938500623 2:131829917-131829939 CCTGCCGGAGCCACCGCCCCCGG - Intergenic
941906075 2:170716768-170716790 CCTGCGGGATGCTCCACCACGGG - Exonic
943119142 2:183711886-183711908 CCGGCGTGAGGCACCGCGCCTGG + Intergenic
944065687 2:195616878-195616900 CAGGCGGGAGCCACCGCCCCCGG + Intronic
946618349 2:221533650-221533672 CCTGGAGGAGGCACAGCCCCCGG - Intronic
946855358 2:223945043-223945065 CCTGCGTGAGGGGGCTCCCCCGG - Intronic
947743745 2:232497123-232497145 CCTGAGGGTTGCACCGCCCCAGG + Intergenic
947745171 2:232503539-232503561 CCTGCGGGACGCGGCGCGGCAGG + Intergenic
947815672 2:233034703-233034725 GCTGGTGGAGCCGCCGCCCCAGG + Exonic
948396010 2:237645520-237645542 CCTGCTGGAGCAGCTGCCCCTGG - Intronic
948738870 2:240029997-240030019 CCAGCTGGAGGCACAGCCCCGGG + Exonic
948740944 2:240045640-240045662 CCAGCTGGAGGCACAGCCCCGGG + Exonic
948770999 2:240251203-240251225 CCTGCAGGAGGCCACGCCTCTGG + Intergenic
949000374 2:241609948-241609970 CCTGTGGGAAGCGGCACCCCGGG + Intronic
949051817 2:241901771-241901793 CCTGCTGGAGACGCCTCTCCTGG - Intronic
949079925 2:242088640-242088662 CCTCAGGGAAGCCCCGCCCCTGG - Intergenic
1168895530 20:1321049-1321071 CCTGTGGGACACGCCTCCCCTGG + Intronic
1169164192 20:3407951-3407973 GCTGGGAGAGGCTCCGCCCCCGG - Intergenic
1169720984 20:8676090-8676112 CAGGCGGGAGCCGCCGCGCCCGG - Intronic
1171217345 20:23362087-23362109 CCCGCGGCCGGCCCCGCCCCTGG - Intergenic
1174146081 20:48453617-48453639 TGAGCGGGAGGCGCTGCCCCTGG + Intergenic
1174454572 20:50640177-50640199 CCTGTGGGAGCCGCAGACCCAGG - Intronic
1174472225 20:50769544-50769566 CCTGTGGGAGCCGCAGACCCAGG + Intergenic
1174573922 20:51523814-51523836 CCTGGTGGAGCAGCCGCCCCTGG - Exonic
1175429575 20:58891873-58891895 CGGGCGGGGGGCGCCGGCCCCGG + Intronic
1177087904 21:16730333-16730355 CCTGCGTGAGCCACCGCACCCGG + Intergenic
1178103977 21:29298772-29298794 CCCGCTGAAGGCCCCGCCCCCGG - Intronic
1178319981 21:31597848-31597870 CCTGCGTGAGGCCCCTCCACGGG - Intergenic
1179728582 21:43354458-43354480 CCTGCGGGAGGCGGCCCCTAGGG + Intergenic
1179912614 21:44458202-44458224 GATGCGGGAGGCCCTGCCCCAGG + Exonic
1179943241 21:44653372-44653394 CCTGTCAGAGGCTCCGCCCCGGG - Intronic
1180069147 21:45427491-45427513 CCTGGGGGAGGCGGAGCCCATGG - Intronic
1180094636 21:45550238-45550260 CAGGCAGGAGGCGCCTCCCCAGG - Intergenic
1180622627 22:17171953-17171975 CCTCCAGGGGGCGCCGCCTCCGG - Intergenic
1181024565 22:20120647-20120669 CCAGCGGGAGGGGCTGCTCCTGG + Intronic
1181026643 22:20131196-20131218 CCTGCGGGAGGAGACGCGCCGGG + Intronic
1181941881 22:26483974-26483996 GCGGAGGGAGGCGGCGCCCCGGG + Exonic
1182619936 22:31613431-31613453 CCTCCTGGAGGAGCTGCCCCTGG - Exonic
1183201290 22:36387397-36387419 CTTCCGGGAGCCGCGGCCCCTGG - Intronic
1183405831 22:37630129-37630151 CCTGCAGCAGTCGCTGCCCCCGG + Exonic
1183665567 22:39244119-39244141 CCCCCGGGCGCCGCCGCCCCCGG + Exonic
1184131113 22:42516998-42517020 CATGCGTGAGCCACCGCCCCTGG - Intronic
1184141285 22:42578857-42578879 CATGCGTGAGCCACCGCCCCTGG - Intergenic
1184229701 22:43151895-43151917 CCTGCAGGAAGCGCGGTCCCAGG + Intronic
1184465941 22:44668884-44668906 CCTGCGGAAGGGGGGGCCCCGGG + Intronic
1185054233 22:48569730-48569752 CCTGCGGGAGGCCACCCCCCGGG - Intronic
950020889 3:9787017-9787039 CCTGCAGGAGGCGCTGCGTCAGG + Exonic
950728869 3:14939010-14939032 CCTGGGGGATGCGCCTCCCGGGG + Intergenic
953636794 3:44671094-44671116 CCTGAAGGAGGAGCAGCCCCGGG + Intergenic
953793597 3:45966696-45966718 CCTGCAGGAGGAGCTGTCCCAGG - Exonic
954004188 3:47578752-47578774 CCGGCGGGAGGCGCGGCGGCCGG - Exonic
954330928 3:49889946-49889968 GCTGGGGCAGGCGCCGACCCTGG + Exonic
954339336 3:49940389-49940411 GATGAGGGAGGCGCCGCCCGTGG + Intronic
955750993 3:62185315-62185337 CATGCGGGAGGTGCCACACCCGG - Intronic
961609197 3:128123392-128123414 GCTGGGTGAGGGGCCGCCCCAGG - Intronic
961810659 3:129519797-129519819 CCTCTGGGAGGCGTGGCCCCTGG + Intronic
963827286 3:149970200-149970222 GCTGTGGGAGGCGGCGGCCCCGG - Intronic
966096805 3:176213681-176213703 CCTGCCGGCCCCGCCGCCCCGGG - Intergenic
968230702 3:197003189-197003211 GCTACCTGAGGCGCCGCCCCCGG - Exonic
968550847 4:1222756-1222778 CCTGAGGGCGGCGCCTTCCCAGG - Intronic
968775487 4:2537135-2537157 AGCGCGGGCGGCGCCGCCCCCGG + Intronic
968830835 4:2932359-2932381 CCTGCCAGAGACGCTGCCCCTGG - Exonic
969053162 4:4386768-4386790 GCTGCGGGCTGCGCCACCCCGGG - Exonic
969411649 4:7032234-7032256 CCTGTGGGAGGGGCCGCCTGAGG + Exonic
972396470 4:38663573-38663595 CCAGCGGGAAGGGCGGCCCCGGG - Intergenic
972533184 4:39978035-39978057 CCTCCGGGAGGCGCCCCGCGCGG - Intergenic
972793862 4:42397799-42397821 CCTGCGGGAGGCGCCGGCAGAGG - Intergenic
973635945 4:52862219-52862241 CCTACACGAGGCCCCGCCCCCGG - Intergenic
974299263 4:60042480-60042502 CCAGCTGGAGCCGCCGGCCCAGG - Intergenic
982137018 4:152281653-152281675 CCTGCGGGAGGGGAGCCCCCAGG - Intergenic
983402853 4:167287167-167287189 CCGGCGTGAGCCACCGCCCCTGG + Intergenic
984167596 4:176320574-176320596 CGCGCGGGAGGCGCCAGCCCAGG - Intronic
984975138 4:185223522-185223544 CAGGCGTGAGCCGCCGCCCCCGG - Intronic
985553068 5:543048-543070 CCTGCAGCAGGCTCCTCCCCTGG - Intergenic
985648001 5:1094054-1094076 CCTGTGGGAGGCCCCGGCCTGGG + Intronic
986414113 5:7511296-7511318 CAGGCGTGAGGCACCGCCCCTGG - Intronic
987705597 5:21459416-21459438 TCTGCGGAAGGCGCCGCTCTTGG + Intergenic
988513306 5:31883933-31883955 CATGCGGGAGCCACCGCGCCCGG - Intronic
989057484 5:37379221-37379243 TCTGCGGAAGGCGCCGCTCTTGG + Exonic
990308695 5:54518148-54518170 CCGGCGGGAGACGGCGGCCCGGG + Exonic
992444053 5:76818980-76819002 CCTGCGGGAGGCCACGCCCCGGG - Exonic
997521744 5:134527613-134527635 GCTGCGGGGGGCTCCGGCCCAGG - Intronic
998005127 5:138651623-138651645 CCTGCAGGATGAGCAGCCCCTGG - Intronic
1002069375 5:176670262-176670284 CCTGCTGGAGGTGACGCCACCGG + Intergenic
1002182069 5:177435883-177435905 CCTGCAGGAGGCCGCGCCCAGGG - Intronic
1002300259 5:178253756-178253778 CAGGCGGGAGCCGCCGCGCCCGG + Intronic
1002362321 5:178682150-178682172 CAGGCGGGAGCCGCCGCACCCGG + Intergenic
1003139099 6:3456562-3456584 TCTGCGGGAGCCGCGGGCCCGGG - Intronic
1005465655 6:26109813-26109835 CATGCGTGAGCCGCCGCGCCCGG + Intergenic
1005588560 6:27301043-27301065 CCGGCGTGAGCCGCCGCGCCGGG + Intronic
1005940469 6:30556265-30556287 CCTGCGGCGGGGGCTGCCCCGGG - Exonic
1006183326 6:32166832-32166854 CTTGCGGGAGGCGCGCCCCACGG + Intronic
1006459774 6:34151632-34151654 CCTGCAGGAGGCGGTGCCCTGGG + Intronic
1006472747 6:34237552-34237574 CCTGCGGGGGGCGGGGACCCGGG + Intronic
1006780018 6:36626285-36626307 CCGGCGTGAGCCACCGCCCCCGG + Intergenic
1008381875 6:50845975-50845997 CCTCCAGGAGCCGGCGCCCCGGG - Exonic
1009022700 6:57961470-57961492 TCTGCGGAAGGCGCCGCTCTTGG - Intergenic
1011443103 6:87408267-87408289 CCTGCCGGAGGCGCCACCCCAGG + Intronic
1011618135 6:89216660-89216682 CCTGCAGGAGGCTCCGTCCCTGG + Intronic
1012450520 6:99349401-99349423 CATGCGGGCGGCGCGGGCCCTGG - Exonic
1015842231 6:137488396-137488418 GCTGGGGAAGGCGCCGCCCCCGG + Intergenic
1017810688 6:157981692-157981714 GCTGCGCGAGGCCGCGCCCCGGG - Intergenic
1017810814 6:157982100-157982122 CCTCCGGGCGTCGCTGCCCCCGG - Intronic
1018156572 6:160991421-160991443 CCGGCCGGAGTCGCCGCCCAGGG - Intergenic
1018368806 6:163149234-163149256 CCCGCGGGAGGCGTCCCCTCCGG - Intronic
1018614835 6:165676914-165676936 CCTGCTGGAGGAGCTGGCCCTGG - Intronic
1018719744 6:166563470-166563492 TCTGGGGGAGCCGCAGCCCCTGG - Intronic
1019467867 7:1200205-1200227 CCTGGGGAAGGCGCCGCGCTTGG + Intergenic
1019546720 7:1581120-1581142 CCTGGGGGAGGCGGGGTCCCTGG - Intergenic
1021313234 7:19117398-19117420 CCCGCGCGCGGCGCCGGCCCGGG + Exonic
1022733950 7:33058626-33058648 CAGGCGGGAGCCGCCGCGCCTGG + Intronic
1024639450 7:51317110-51317132 CCGCCAGGAGGCGCCGGCCCCGG - Intergenic
1025017120 7:55448789-55448811 CGAGGGGGAGGCGGCGCCCCTGG + Intronic
1026959697 7:74400477-74400499 CCTGCGGGATGCGCTGGACCAGG + Exonic
1027219086 7:76202487-76202509 CCAGCAGGAGGTGCCGGCCCAGG + Intronic
1030049107 7:105522300-105522322 CCTGCCGCCGGCCCCGCCCCCGG + Intergenic
1030216131 7:107045101-107045123 CTTGCTGGGGGTGCCGCCCCCGG - Exonic
1034417808 7:150974518-150974540 CCTGTGGGAGGCGCGGTTCCGGG - Intronic
1035537961 8:406905-406927 CCTCAGGGAAGCCCCGCCCCTGG - Intronic
1035553019 8:544676-544698 CCTGCGTGGGGGGCCGCCACCGG - Exonic
1035664848 8:1373328-1373350 CCTTCCGGAGGCGCCGCGCCTGG + Intergenic
1035872756 8:3153688-3153710 CCTGCAGGAGGGGCTGGCCCAGG + Intronic
1036200423 8:6766275-6766297 CATGCGTGAGTCACCGCCCCCGG + Intergenic
1037336996 8:17801346-17801368 CCTTCGGAAGGAGCCGCCCCGGG - Intergenic
1039454320 8:37697383-37697405 TTTGCGGGAGTCGCCGCCGCCGG - Exonic
1039554724 8:38467857-38467879 GCGGAGGGAGGCGCCGGCCCCGG + Intronic
1041558525 8:59186947-59186969 CAGGCGTGAGCCGCCGCCCCTGG + Intergenic
1042859043 8:73295027-73295049 CCGGCAGGAGGCGCCGAGCCGGG + Exonic
1047213896 8:122861900-122861922 CCGGCGGGAGGAGGCGCCCCAGG - Intronic
1049237027 8:141517571-141517593 CCAGAGGGAGGTGCGGCCCCAGG - Intronic
1049488462 8:142878613-142878635 CCTGAGGGAGGCTGCGGCCCCGG + Intronic
1049532339 8:143160664-143160686 CCTGCGCGTGGCGCCGCGCCGGG - Exonic
1049665585 8:143841229-143841251 CCTTCGCGAAGCCCCGCCCCAGG + Intergenic
1049784490 8:144444076-144444098 CTTCCGGCAGACGCCGCCCCAGG - Intronic
1052781217 9:32783403-32783425 CCGGCGGCAGGCGCTGCCCGGGG - Intergenic
1055722714 9:79193745-79193767 CCGGCGGGAGGCGCCGGAGCGGG + Intergenic
1059375300 9:113876353-113876375 CGTGCGGGAGGAGGCGGCCCCGG - Exonic
1059496326 9:114712334-114712356 CAGGCGTGAGGCGCCGCGCCTGG + Intergenic
1060523942 9:124309972-124309994 CCTGCCCCAGGCCCCGCCCCAGG - Intronic
1060952312 9:127612173-127612195 CCGGCGCGAGGCCCCGCCCCCGG + Intergenic
1061693705 9:132355263-132355285 CCTGCGGGTGGGGCGGCTCCGGG + Intergenic
1061991743 9:134163177-134163199 GCTGCGGGAGGCGCAGGCCCCGG - Intergenic
1062290834 9:135793659-135793681 GCTGCTGGAGGGGCCGGCCCTGG + Intergenic
1062499062 9:136844612-136844634 CCTGCCGGAGCCACCGCCGCCGG + Exonic
1062641753 9:137522349-137522371 CAGGCGGGAGCCGCCGCGCCCGG + Intronic
1062703234 9:137919112-137919134 CCTGCGGGAGGCAGAGACCCAGG - Intronic
1203773624 EBV:61325-61347 CCTGTGGCAGGCCCCGGCCCCGG - Intergenic
1185464458 X:346406-346428 CCTGCGGGAGGCGCCGCCCCAGG + Intronic
1189899116 X:45687462-45687484 CCTGCGTGAGCCACCGCGCCCGG + Intergenic
1196871238 X:120115592-120115614 CCCGCCGGAGGAGCCGGCCCAGG - Exonic
1201762716 Y:17557631-17557653 CCTGCGGGAGGCCAGGCCACCGG + Intergenic
1201838836 Y:18348358-18348380 CCTGCGGGAGGCCAGGCCACCGG - Intergenic