ID: 1185465544

View in Genome Browser
Species Human (GRCh38)
Location X:352377-352399
Sequence CCTGGGGGCCGTCGCCGTAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 43}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185465544_1185465558 18 Left 1185465544 X:352377-352399 CCGCTACGGCGACGGCCCCCAGG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 1185465558 X:352418-352440 AGTTCACCTTTTCCAGGACACGG 0: 1
1: 0
2: 0
3: 20
4: 205
1185465544_1185465560 24 Left 1185465544 X:352377-352399 CCGCTACGGCGACGGCCCCCAGG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 1185465560 X:352424-352446 CCTTTTCCAGGACACGGCAACGG 0: 1
1: 0
2: 0
3: 17
4: 110
1185465544_1185465556 12 Left 1185465544 X:352377-352399 CCGCTACGGCGACGGCCCCCAGG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 1185465556 X:352412-352434 GGCTCCAGTTCACCTTTTCCAGG 0: 1
1: 0
2: 0
3: 13
4: 165
1185465544_1185465546 -9 Left 1185465544 X:352377-352399 CCGCTACGGCGACGGCCCCCAGG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 1185465546 X:352391-352413 GCCCCCAGGCCTCCTCCCCGTGG 0: 1
1: 2
2: 6
3: 44
4: 486
1185465544_1185465561 25 Left 1185465544 X:352377-352399 CCGCTACGGCGACGGCCCCCAGG 0: 1
1: 0
2: 0
3: 3
4: 43
Right 1185465561 X:352425-352447 CTTTTCCAGGACACGGCAACGGG 0: 1
1: 0
2: 0
3: 5
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185465544 Original CRISPR CCTGGGGGCCGTCGCCGTAG CGG (reversed) Intronic
900398421 1:2462712-2462734 CCTGGGGGCTGAGGCAGTAGGGG + Intronic
903034442 1:20485319-20485341 CGTCGCCGCCGTCGCCGTAGGGG + Exonic
905655523 1:39684125-39684147 ACTTGGAGGCGTCGCCGTAGGGG + Exonic
923490278 1:234478422-234478444 CCTGGGGTCCGGCCGCGTAGAGG - Exonic
924833825 1:247628354-247628376 CCTGTGGGCCGTGGTGGTAGTGG - Intergenic
1075463085 10:122631733-122631755 CCTGGGGACCCTCGCCGAGGGGG + Intronic
1104648124 12:130511530-130511552 CCTGGGGGCTGTACCAGTAGAGG - Intronic
1107141329 13:37000904-37000926 CCTGGAGGCCGACCCCGTTGGGG + Intronic
1121439374 14:93939179-93939201 GGTGCGGGCCGTTGCCGTAGAGG + Exonic
1122658609 14:103279418-103279440 CCGCGGAGCCGTCGCCGTGGCGG - Intergenic
1124108249 15:26761668-26761690 CCTGGGGGCTGTGGCAGCAGAGG - Intronic
1125541390 15:40471660-40471682 CCTTGGGGACGTAGCAGTAGAGG - Exonic
1129880662 15:79004234-79004256 CCTGGGGGCCGTCTCCGGTGGGG + Intronic
1132729041 16:1351711-1351733 CCTGGAGGCCTTCGCCGAGGAGG - Exonic
1133867815 16:9660266-9660288 CCTGGAGGCCAACGTCGTAGTGG + Intergenic
1139361579 16:66402965-66402987 AGGGGGGGCCGTCGCCGTCGTGG - Exonic
1140664260 16:77213426-77213448 CCTCGGGGCCTTCGCCCTACTGG + Intergenic
1142686248 17:1578395-1578417 CCTGGGGGCCCTCACCCCAGGGG + Intronic
1142898212 17:2995820-2995842 CCTGGGGGCCCTGGTCATAGAGG + Intronic
1143783246 17:9240276-9240298 CCTGGGCGCGGCCGCCGTGGAGG + Exonic
1146052126 17:29562640-29562662 CTTGGGGGCCGTCGTCGTGGGGG - Exonic
1155199340 18:23503569-23503591 CCCGGGGGCGGTCGCCAGAGTGG - Exonic
1165395494 19:35561469-35561491 CATGGGGGCCGTGGCCACAGAGG - Intronic
1165452217 19:35890282-35890304 CCTGGGGGCTGTGGACGTGGAGG - Intronic
1167078038 19:47260750-47260772 GCTGGGGGCCGTGGCCGGAGGGG + Exonic
1168076279 19:53982410-53982432 CCAGCGAGCCGTCGCCGTCGCGG + Exonic
948577956 2:238966205-238966227 CCTGGGGGCCGCCGCACTTGCGG - Intergenic
1172792286 20:37514084-37514106 CCTTGGGGCCGATGCTGTAGTGG + Intronic
1174402384 20:50282976-50282998 GCTGGTGGCCGTGGCCGAAGCGG - Intergenic
1179053873 21:37914399-37914421 CCTGGGGGCCGCCGAGGTGGTGG - Intronic
1179976929 21:44873578-44873600 CCCGCGGGCCGACGCCGTACTGG - Exonic
1180614759 22:17120203-17120225 CCTGGGGGCGGCCGCGGCAGCGG - Exonic
957824699 3:85425785-85425807 CCAGGGGGCCATCGCCATTGTGG + Intronic
961012878 3:123448008-123448030 GCTGGAGGCCGGCGCCGTCGAGG - Exonic
968065144 3:195754315-195754337 CCTCGGAGCCCTCGCAGTAGCGG + Exonic
968855858 4:3121390-3121412 TCTGGTGGCCGAAGCCGTAGTGG + Exonic
996000913 5:118362453-118362475 ACTGGGGGCTGTCGGTGTAGGGG + Intergenic
1002400759 5:178990628-178990650 CCTGGAGGACGTGGCCGTTGGGG - Exonic
1012996675 6:105981866-105981888 CCGTGTGGCCCTCGCCGTAGTGG - Intergenic
1021969272 7:25951077-25951099 CCTGGCGGCCGGCGCTGGAGGGG - Intergenic
1022454419 7:30546066-30546088 CCAGGGGGCCATCGCCATTGTGG - Intronic
1024579779 7:50792801-50792823 CCTGGGGGCCGCCGCCTGGGAGG - Intronic
1028796355 7:94907943-94907965 CCTGGGGGCCGACGCGCGAGTGG + Intronic
1039588669 8:38728650-38728672 TCTGGGGACCCTCGCCGAAGAGG + Intronic
1049468867 8:142766459-142766481 CCTGGGTGCCGCCACTGTAGCGG - Intronic
1049804524 8:144532870-144532892 CCTGGTGGCCGTCTCTGCAGGGG + Intronic
1185465544 X:352377-352399 CCTGGGGGCCGTCGCCGTAGCGG - Intronic