ID: 1185466133

View in Genome Browser
Species Human (GRCh38)
Location X:355414-355436
Sequence CTGTTGACTCCAGATGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 137}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185466133_1185466143 24 Left 1185466133 X:355414-355436 CCAAGTTCATCTGGAGTCAACAG 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1185466143 X:355461-355483 TGTCGTAGCAACGGAGGGACCGG 0: 1
1: 0
2: 0
3: 0
4: 32
1185466133_1185466142 19 Left 1185466133 X:355414-355436 CCAAGTTCATCTGGAGTCAACAG 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1185466142 X:355456-355478 CAGGCTGTCGTAGCAACGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 39
1185466133_1185466141 18 Left 1185466133 X:355414-355436 CCAAGTTCATCTGGAGTCAACAG 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1185466141 X:355455-355477 GCAGGCTGTCGTAGCAACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 41
1185466133_1185466140 15 Left 1185466133 X:355414-355436 CCAAGTTCATCTGGAGTCAACAG 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1185466140 X:355452-355474 CCAGCAGGCTGTCGTAGCAACGG 0: 1
1: 0
2: 0
3: 4
4: 76
1185466133_1185466135 0 Left 1185466133 X:355414-355436 CCAAGTTCATCTGGAGTCAACAG 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1185466135 X:355437-355459 GATGCCCATGTAATCCCAGCAGG 0: 1
1: 0
2: 2
3: 12
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185466133 Original CRISPR CTGTTGACTCCAGATGAACT TGG (reversed) Intronic
902103352 1:14012422-14012444 CTCTTGACTCCAGATGAAAATGG + Intergenic
903355934 1:22747418-22747440 CTGTTGATGCCAGACCAACTAGG + Intronic
909198868 1:72663227-72663249 CTCTTGTCTGCAGCTGAACTGGG - Intergenic
910894099 1:92049606-92049628 CTTTTGAGGCCAGATGAACAAGG + Intronic
912120293 1:106463163-106463185 GCTTTGACTTCAGATGAACTAGG - Intergenic
913681782 1:121192799-121192821 TTATTCACTCCAGATAAACTGGG + Intronic
914033617 1:143980425-143980447 TTATTCACTCCAGATAAACTGGG + Intergenic
914155829 1:145087547-145087569 TTATTCACTCCAGATAAACTGGG - Intronic
915076646 1:153313153-153313175 CTGGTGACTCCAGTGGAACCTGG - Intergenic
915841974 1:159220976-159220998 CTGTTGGCTCCATTTGAACAGGG + Intergenic
917113296 1:171575005-171575027 CTGCTGACTCCAGTTGCAATTGG - Exonic
918239195 1:182606885-182606907 CTGCTGACCCCAGATGACCCAGG - Intergenic
919862459 1:201749583-201749605 CTGTTTATGCCAGTTGAACTTGG + Intronic
920469098 1:206211312-206211334 TTATTCACTCCAGATAAACTGGG + Intronic
921000806 1:211040860-211040882 CTGTTGAAACAAGATGAAGTAGG - Intronic
923328156 1:232898682-232898704 CTGTGGACTCCACATGGAATTGG - Intergenic
1068507502 10:57920930-57920952 CTGTTGCCTGCAGCTGATCTAGG + Intergenic
1068870806 10:61942289-61942311 CAGTTGATTCCAGAAGAAATTGG + Intronic
1069270569 10:66521919-66521941 CTGTTGTCTGCAGCTGATCTGGG + Intronic
1078734898 11:14010877-14010899 CTGTCTACTGCAGATGAAATTGG + Intronic
1078821653 11:14889574-14889596 CTCTTGACTACAAATGAAATAGG - Intronic
1082948379 11:58785357-58785379 CTGTTGTCTGCAGCTGAACTGGG + Intergenic
1083122235 11:60525023-60525045 ATGTTTCCTCCAGATTAACTGGG + Intronic
1083735499 11:64677963-64677985 CTTTTGCCTCCAAATGAAATTGG - Intronic
1084967824 11:72753555-72753577 TTTTTGACCCCATATGAACTTGG - Intronic
1085838915 11:79987477-79987499 CTGTGGATACCAGATGAACCGGG - Intergenic
1086020161 11:82218151-82218173 CTGTTGACTCCATAGTAACAAGG + Intergenic
1092584147 12:9878960-9878982 CTGTTGACTATAGATGTATTGGG + Intergenic
1094540961 12:31362930-31362952 CTCTTTACTCCAGAGGAGCTAGG - Intergenic
1100149533 12:91719540-91719562 CTACAGACTCCAGATGAACTCGG - Intergenic
1102570593 12:113824921-113824943 GTGATGCCTCCAGAGGAACTTGG - Intronic
1103001108 12:117386039-117386061 ATGTTGAGTCCATATGAAGTGGG - Intronic
1108070397 13:46623152-46623174 CTGTAGATTCCATATGAGCTGGG + Intronic
1108613931 13:52112428-52112450 CTGTGGAATCAAGATGGACTGGG + Intronic
1109011540 13:56954193-56954215 CTGTTAACTCCAGAAGTACCTGG - Intergenic
1111297908 13:86307440-86307462 CTTTAGACTCTAGATGAATTTGG + Intergenic
1111915117 13:94352426-94352448 CTGCTGACTCCAGTTAACCTTGG + Intronic
1113149072 13:107241981-107242003 CTGCTGACTCTAGATGATATTGG + Intronic
1115759993 14:36570423-36570445 CTATAGACTCCAGAAGAATTCGG - Intergenic
1115823120 14:37234086-37234108 CTGTTGTCTGCAGCTGATCTGGG + Intronic
1117344600 14:54819915-54819937 CTGTTCTCACCAGAGGAACTGGG + Intergenic
1119632603 14:76246734-76246756 CTGGTGACTGAAGATGCACTTGG + Intronic
1123576947 15:21680134-21680156 CAGTTGACTCCAGAAAAACATGG + Intergenic
1123613569 15:22122602-22122624 CAGTTGACTCCAGAAAAACATGG + Intergenic
1127798427 15:62457500-62457522 CTGGTGACTGCAGAGGAATTGGG + Intronic
1129520795 15:76184822-76184844 CTGTGGATCCCAGATGATCTGGG + Intronic
1131810134 15:96164561-96164583 CTGTTGAGTCCAGAGGTAGTTGG - Intergenic
1202985815 15_KI270727v1_random:414379-414401 CAGTTGACTCCAGAAAAACATGG + Intergenic
1136017736 16:27415260-27415282 CTGTTGTCTGCAGCTGATCTGGG - Intronic
1141043131 16:80689529-80689551 CTGTTGCAGTCAGATGAACTTGG - Intronic
1141884200 16:86880572-86880594 CTGTTGGCTCCACATGATGTAGG - Intergenic
1142706940 17:1701375-1701397 CTGTTGACTCAGGATTAATTTGG + Intergenic
1146563933 17:33895614-33895636 CTGTTGGCTCCAAGTAAACTAGG - Intronic
1147549031 17:41425267-41425289 TTGTTTACTCCTGATGAACAGGG - Intergenic
1157358185 18:46954233-46954255 CTGATGACTCCAGAGGAACCTGG + Intronic
1157752474 18:50192241-50192263 CTGTTGTCTGCAGTTGATCTGGG - Intronic
1159213681 18:65362951-65362973 CTAATGAGTCCAGATGAAATTGG - Intergenic
1164126476 19:22322927-22322949 CTCTTGACTCCAGATAAACTTGG - Intergenic
925867628 2:8243038-8243060 AAGGTGACCCCAGATGAACTTGG - Intergenic
928092325 2:28382587-28382609 TTCTTTGCTCCAGATGAACTGGG + Intergenic
931593908 2:63919145-63919167 ATGATGACTCCACCTGAACTAGG + Intronic
934220902 2:90081819-90081841 CAGTTGGATCCAGATGAAATTGG - Intergenic
938150098 2:128875035-128875057 ATGTTGATTGCAGATGAACAGGG + Intergenic
948297435 2:236872605-236872627 ATATTGACTCCAGATTAAATAGG - Intergenic
1168833521 20:860744-860766 CTGTTTACCCCAGGTGAACAGGG + Intergenic
1170944580 20:20879709-20879731 CTGTCGACTGCAGATGTAGTTGG - Intergenic
1171157483 20:22889727-22889749 CTTTTGACCCCAGGTGAAGTGGG - Intergenic
1174752265 20:53123293-53123315 CTGTGGAGTACAGATGACCTGGG + Intronic
1176055417 20:63143338-63143360 CTCTTGTCTCCAGCTGATCTGGG + Intergenic
1176345414 21:5739844-5739866 GTGTTTGCTCCAGGTGAACTGGG + Intergenic
1176352228 21:5860428-5860450 GTGTTTGCTCCAGGTGAACTGGG + Intergenic
1176499413 21:7584611-7584633 GTGTTTGCTCCAGGTGAACTGGG - Intergenic
1176539735 21:8137914-8137936 GTGTTTGCTCCAGGTGAACTGGG + Intergenic
1176558686 21:8320959-8320981 GTGTTTGCTCCAGGTGAACTGGG + Intergenic
1176932432 21:14829525-14829547 CTGGAGCCTTCAGATGAACTAGG + Intergenic
1177581211 21:23023580-23023602 GTGTAGAGTCCAGATGAATTTGG - Intergenic
1178670278 21:34583988-34584010 CTGTTTACTCCCAATTAACTTGG + Intronic
1180867738 22:19129060-19129082 CTGTGTACTCCAGATGGAGTGGG + Intergenic
1182649805 22:31842223-31842245 ATGGTGACTTCAGATGATCTGGG + Intronic
1182658830 22:31910719-31910741 CTCCTGACTTCAGATGATCTTGG - Intergenic
1203244686 22_KI270733v1_random:54269-54291 GTGTTTGCTCCAGGTGAACTGGG + Intergenic
950568486 3:13785908-13785930 CTGAGGTTTCCAGATGAACTGGG - Intergenic
953758758 3:45670216-45670238 ATGTTGACTTCATATGAAGTAGG - Intronic
954442954 3:50531639-50531661 CTGGTGAATCCAGATGCTCTGGG - Intergenic
958018761 3:87972457-87972479 CTGGTGACTACAGATGCACAAGG + Intergenic
959921800 3:111876308-111876330 CAGTTGACTCTAGAGCAACTTGG + Intronic
965049318 3:163624326-163624348 CTCTTGACTGCAGCTGATCTGGG - Intergenic
971065512 4:23027559-23027581 CTCTAGACTCCAGATGTATTTGG - Intergenic
972619631 4:40734264-40734286 CTGTTTACTACAGATGATCAAGG + Intergenic
975021900 4:69501223-69501245 TTGGAGAGTCCAGATGAACTGGG + Intronic
976652210 4:87448067-87448089 CTTTTGACACCAGCTAAACTGGG + Intronic
978143542 4:105345113-105345135 CTAGTGACTCCAGATGAAAAGGG + Intergenic
980273379 4:130616035-130616057 ATGTTACCTCCATATGAACTAGG + Intergenic
981941628 4:150287493-150287515 CTGCTGGCTCCAGGTGAAGTGGG - Intronic
983502230 4:168512362-168512384 CTCTACACTCCAGATAAACTCGG - Exonic
984350343 4:178582568-178582590 CAATTGACTTCAGATGAACTAGG + Intergenic
985115597 4:186586987-186587009 CTGTTGACTCCCTATGATGTTGG - Intergenic
986549141 5:8933747-8933769 GTGTTGTCTTCAGATGGACTGGG + Intergenic
987488098 5:18545546-18545568 CATTTGACTCCAGAAGAAATTGG + Intergenic
988495348 5:31740563-31740585 CTGTTGTCTGCAGCTGACCTGGG + Intronic
988884435 5:35539975-35539997 CTGTGGCCTCCAGGAGAACTAGG - Intergenic
991471425 5:66973005-66973027 CTGGTGAATCAAGATGAACATGG - Intronic
993825548 5:92681550-92681572 CTGTTGAGTACAGATCACCTTGG - Intergenic
993880851 5:93359342-93359364 CTGTTGACTCAGGATGCATTGGG - Intergenic
997108052 5:131044439-131044461 CTGTTAATTCTCGATGAACTAGG + Intergenic
997206671 5:132054216-132054238 CTCCTGGCTCCAGATGCACTGGG + Intergenic
998496828 5:142598062-142598084 CTGCTGCCTCTAGAGGAACTTGG + Intronic
999192569 5:149759562-149759584 CTGTTGACCCAAGTTGGACTTGG + Intronic
999373773 5:151072328-151072350 CTGTTGACTGCAGGTGATGTGGG - Intronic
999574580 5:152961767-152961789 CTGTAAACTCCAGGGGAACTGGG - Intergenic
1001648181 5:173297462-173297484 CTGCTGACTCCTGATGCCCTTGG + Intergenic
1002189770 5:177472519-177472541 CTGTTGTCTCCCGCTGAGCTGGG - Intronic
1003647115 6:7921856-7921878 CTGTTGTCTCAAGATGATCCTGG - Intronic
1004289030 6:14349906-14349928 CTTTTGACTAAAGGTGAACTTGG + Intergenic
1005570410 6:27139784-27139806 CTGATGACTACAGGTGACCTTGG + Exonic
1006846570 6:37066219-37066241 CTGTTGTCTGCAGCTGATCTGGG - Intergenic
1007154397 6:39728310-39728332 GGGTTGACTGCAGATGAACATGG + Intergenic
1007647789 6:43396106-43396128 CCGTTGACCCCAGAGGAACTTGG - Intergenic
1011975844 6:93297309-93297331 GTGTAGACTCTACATGAACTAGG + Intronic
1012952195 6:105530176-105530198 CTCTGGCTTCCAGATGAACTGGG - Intergenic
1013263631 6:108471872-108471894 ATAATGACTCCAGAGGAACTTGG - Intronic
1014000354 6:116358516-116358538 CTGAAGACTCCAGATCAACCAGG + Intronic
1016588105 6:145712371-145712393 CTGTTGTCTGCAGCTGATCTGGG - Intronic
1018631429 6:165826206-165826228 CTGTAGACTCCAGGTGACCTGGG + Intronic
1021707204 7:23379664-23379686 CTTTAAACTCCAGGTGAACTTGG - Intronic
1022103213 7:27181258-27181280 CTGTTGGCTCCATTTGTACTGGG - Intergenic
1024485837 7:49918612-49918634 CTCTTGGCTCCAGAAAAACTGGG - Exonic
1024525018 7:50340659-50340681 CTGTGCTCTCCAGTTGAACTTGG + Intronic
1025146868 7:56512818-56512840 CTATTGACTCCAGGTATACTTGG + Intergenic
1030547422 7:110914265-110914287 CTGTTGTCTGCAGTTGATCTGGG + Intronic
1031055278 7:116986615-116986637 CAGTTGACATCAGATGAAATGGG + Intronic
1032302491 7:130700522-130700544 CCATTGACTACAGATGTACTGGG - Intergenic
1032763621 7:134968635-134968657 CTGTTGACTTCAGATGTGGTTGG - Exonic
1036958118 8:13213410-13213432 CTGATGAGTCCTGATTAACTTGG - Intronic
1037056479 8:14448360-14448382 CAGTTTACTCCAGAGGAAATTGG - Intronic
1039492180 8:37956096-37956118 CTGTTTTCTCCAGAAGATCTTGG - Intergenic
1039884972 8:41649524-41649546 CTGCTGAGTCCAGCTGAACTTGG - Intronic
1041913448 8:63114691-63114713 CTGTAGACTCCAAATGGAGTTGG + Intergenic
1047675394 8:127196338-127196360 CTGGTGACACAAGATGAATTGGG - Intergenic
1058542181 9:106023000-106023022 CTGTTGCCACGAGATGAGCTGGG + Intergenic
1203461018 Un_GL000220v1:37352-37374 GTGTTTGCTCCAGGTGAACTGGG + Intergenic
1185466133 X:355414-355436 CTGTTGACTCCAGATGAACTTGG - Intronic
1187411204 X:19051854-19051876 CAGTTGATTCCATGTGAACTAGG + Intronic
1188059501 X:25583650-25583672 CTGTTGAATCTAGATGTATTGGG - Intergenic
1192865991 X:75132478-75132500 CTGTTGACTCCAGCTGAAGAGGG + Intronic
1195678603 X:107526439-107526461 CTGTTGGCTCCAGAGGATGTAGG + Intronic
1197323648 X:125064983-125065005 CTGTTGCCTACAGCTGATCTGGG - Intergenic
1199787537 X:151118417-151118439 CTGCTGACACCAGAGGGACTTGG + Intergenic