ID: 1185466136

View in Genome Browser
Species Human (GRCh38)
Location X:355441-355463
Sequence ACAGCCTGCTGGGATTACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 472
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 443}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185466136_1185466141 -9 Left 1185466136 X:355441-355463 CCCATGTAATCCCAGCAGGCTGT 0: 1
1: 0
2: 2
3: 26
4: 443
Right 1185466141 X:355455-355477 GCAGGCTGTCGTAGCAACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 41
1185466136_1185466142 -8 Left 1185466136 X:355441-355463 CCCATGTAATCCCAGCAGGCTGT 0: 1
1: 0
2: 2
3: 26
4: 443
Right 1185466142 X:355456-355478 CAGGCTGTCGTAGCAACGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 39
1185466136_1185466144 14 Left 1185466136 X:355441-355463 CCCATGTAATCCCAGCAGGCTGT 0: 1
1: 0
2: 2
3: 26
4: 443
Right 1185466144 X:355478-355500 GACCGGCTCTAAAATTCACACGG 0: 1
1: 0
2: 0
3: 10
4: 123
1185466136_1185466146 17 Left 1185466136 X:355441-355463 CCCATGTAATCCCAGCAGGCTGT 0: 1
1: 0
2: 2
3: 26
4: 443
Right 1185466146 X:355481-355503 CGGCTCTAAAATTCACACGGTGG 0: 1
1: 0
2: 0
3: 2
4: 25
1185466136_1185466147 18 Left 1185466136 X:355441-355463 CCCATGTAATCCCAGCAGGCTGT 0: 1
1: 0
2: 2
3: 26
4: 443
Right 1185466147 X:355482-355504 GGCTCTAAAATTCACACGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 51
1185466136_1185466143 -3 Left 1185466136 X:355441-355463 CCCATGTAATCCCAGCAGGCTGT 0: 1
1: 0
2: 2
3: 26
4: 443
Right 1185466143 X:355461-355483 TGTCGTAGCAACGGAGGGACCGG 0: 1
1: 0
2: 0
3: 0
4: 32
1185466136_1185466148 30 Left 1185466136 X:355441-355463 CCCATGTAATCCCAGCAGGCTGT 0: 1
1: 0
2: 2
3: 26
4: 443
Right 1185466148 X:355494-355516 CACACGGTGGGAACGAACAACGG 0: 1
1: 0
2: 0
3: 8
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185466136 Original CRISPR ACAGCCTGCTGGGATTACAT GGG (reversed) Intronic
901043475 1:6380337-6380359 CCAACATGCTGGGATTACAGGGG - Intronic
901872151 1:12144518-12144540 CCAGTGTGCTGGGATTACAGGGG - Intergenic
902269449 1:15292827-15292849 CCAAACTGCTGGGATTACAGGGG - Intronic
902952607 1:19898206-19898228 CCAAACTGCTGGGATTACAGGGG + Intronic
903038738 1:20512559-20512581 CCAGAGTGCTGGGATTACACAGG - Intergenic
904320746 1:29696594-29696616 ACAGTCTGCTGGGAATCCAGAGG - Intergenic
904502719 1:30925149-30925171 ACAAAGTGCTGGGATTACAGGGG + Intergenic
904729910 1:32582385-32582407 CCAAAGTGCTGGGATTACATGGG - Intronic
904974977 1:34449077-34449099 GGAACCTGCTGGGATTACAGAGG + Intergenic
905206416 1:36345175-36345197 ACAGCCTGCTGGTATACCAGAGG - Intronic
908037781 1:60074276-60074298 ACAAAGTGCTGGGATTACAGGGG - Intergenic
910354757 1:86341826-86341848 ACGGCCTGGTGGGCTTACCTGGG - Intergenic
910403857 1:86864892-86864914 CCAAAGTGCTGGGATTACATAGG + Intronic
913679228 1:121172821-121172843 CCAAAGTGCTGGGATTACATGGG - Intronic
913683755 1:121212388-121212410 TCAGAGTGCTGGGATTACAGGGG + Intronic
914031060 1:143960465-143960487 CCAAAGTGCTGGGATTACATGGG - Intronic
914158388 1:145107497-145107519 CCAAAGTGCTGGGATTACATGGG + Intronic
915339883 1:155171156-155171178 CCAGAGTGCTGGGATTACAGGGG - Intronic
915646674 1:157277516-157277538 ACGGCCTGGTGGGCTTACCTGGG + Intergenic
916721357 1:167486811-167486833 CCAAAGTGCTGGGATTACATAGG - Intronic
917118804 1:171627940-171627962 CCAGAGTGCTGGGATTACAGGGG - Intergenic
918330933 1:183459856-183459878 CCAAAGTGCTGGGATTACATGGG - Intergenic
918355929 1:183706593-183706615 ACAGCCTGGTGGGCTTACCTGGG + Intronic
918546031 1:185684962-185684984 CCAGACTACTGGGATTACAGGGG + Intergenic
918899860 1:190401094-190401116 ACAAAGTGCTGGGATTACAGGGG - Intronic
920466528 1:206191356-206191378 CCAAAGTGCTGGGATTACATGGG - Intronic
921734164 1:218608046-218608068 ACAGCCTGCTGCCATGACAGAGG + Intergenic
922185520 1:223270819-223270841 CCAACGTGCTGGGATTACAGGGG + Intronic
922298590 1:224274372-224274394 AAAAAGTGCTGGGATTACATGGG - Intronic
922685989 1:227639161-227639183 ACAGCCTGGTGGGCTTACCTGGG + Intronic
922914824 1:229248563-229248585 ACAAAGTGCTGGGATTACAGGGG + Intergenic
1063071902 10:2675241-2675263 ACACGCTGCTGAGATTACACAGG - Intergenic
1064130471 10:12705198-12705220 CCAACGTGCTGGGATTACAGGGG - Intronic
1064136125 10:12752254-12752276 CCAGAGTGCTGGGATTACAGGGG + Intronic
1064278114 10:13925841-13925863 CCAGAGTGCTGGGATTACAGGGG + Intronic
1064433765 10:15292744-15292766 CCAACATGCTGGGATTACAGGGG + Intronic
1065350214 10:24788839-24788861 TCAGCCTCCTGGGATTAGCTGGG + Intergenic
1066356127 10:34685852-34685874 CCAAACTGCTGGGATTACAGAGG + Intronic
1066407679 10:35134475-35134497 CCAGAGTGCTGGGATTACAGGGG + Intronic
1068782951 10:60941888-60941910 ACTGCCTGCCAGGAGTACATGGG + Intronic
1070036542 10:72730547-72730569 CCAAAGTGCTGGGATTACATGGG + Intronic
1070046196 10:72839248-72839270 ACAAAGTGCTGGGATTACAGGGG + Intronic
1071767240 10:88681055-88681077 CCAGAGTGCTGGGATTACAGGGG + Intergenic
1073333562 10:102687441-102687463 CCAAAATGCTGGGATTACATGGG - Intronic
1073359914 10:102889934-102889956 CCAAAGTGCTGGGATTACATAGG + Intronic
1073573414 10:104599990-104600012 AAAGCCTGCTGGAAATACTTAGG - Intergenic
1074061920 10:109974287-109974309 CCAGAGTGCTGGGATTACAGGGG - Intergenic
1074256463 10:111807443-111807465 TCAAAGTGCTGGGATTACATGGG - Intergenic
1075695548 10:124432327-124432349 CCAAACTGCTGGGATTACAGGGG - Intergenic
1075768621 10:124914948-124914970 CCAAACTGCTGGGATTACAAGGG + Intergenic
1077230782 11:1457390-1457412 ACAGCCTGATGGGCTCACACAGG + Intronic
1077891801 11:6423621-6423643 ACAAAGTGCTGGGATTACAGGGG + Intergenic
1078003869 11:7517945-7517967 ACGGCCTGGTGGGCTTACCTGGG + Intronic
1079776724 11:24540990-24541012 CCAAACTGCTGGGATTACAGAGG - Intronic
1080884677 11:36355821-36355843 CCAGAGTGCTGGGATTACAGGGG + Intronic
1081498734 11:43644387-43644409 GCAGCCTGATGGGTTAACATTGG + Intronic
1081548511 11:44090567-44090589 CCAAAGTGCTGGGATTACATAGG + Intergenic
1081691161 11:45079645-45079667 ACTGCCTGTTGGGGTGACATGGG + Intergenic
1081874707 11:46400745-46400767 CCAAAATGCTGGGATTACATGGG + Intronic
1081903148 11:46647018-46647040 TCAGAGTGCTGGGATTACAGGGG + Intronic
1083467363 11:62857382-62857404 CCAAACTGCTGGGATTACAGGGG + Intronic
1083957635 11:65994126-65994148 ACAAAGTGCTGGGATTACAAGGG - Intergenic
1084611873 11:70208372-70208394 CCAAAGTGCTGGGATTACATAGG + Intergenic
1084741458 11:71142238-71142260 CCAAAGTGCTGGGATTACATAGG - Intronic
1085616377 11:78002469-78002491 ATAAAGTGCTGGGATTACATAGG + Intergenic
1085904334 11:80741765-80741787 ATAGTCTTCTGGGATTATATGGG - Intergenic
1086864871 11:91968892-91968914 ACAGTCTCATGGCATTACATGGG + Intergenic
1087441448 11:98188725-98188747 CCAAAGTGCTGGGATTACATGGG - Intergenic
1088280140 11:108127074-108127096 CCAAACTGCTGGGATTACAGGGG + Intronic
1088281347 11:108138243-108138265 CCAGAGTGCTGGGATTACAGGGG + Intronic
1090005635 11:123000071-123000093 CCAGAGTGCTGGGATTACAGGGG - Intergenic
1090291299 11:125547437-125547459 CCAGAGTGCTGGGATTACAGAGG - Intergenic
1092235549 12:6806036-6806058 CCAACGTGCTGGGATTACAGCGG - Intronic
1092825559 12:12395545-12395567 CCAGCGTGCCGGGATTACAGGGG + Intronic
1093619789 12:21275678-21275700 CCAGTGTGCTGGGATTACAGGGG - Intronic
1095264156 12:40133892-40133914 CCAAAGTGCTGGGATTACATGGG - Intergenic
1095760860 12:45834480-45834502 CCAAAGTGCTGGGATTACATGGG - Intronic
1095919820 12:47517867-47517889 GCAGCCTACTGGGTTTAAATAGG - Intergenic
1096126614 12:49124260-49124282 CCAAACTGCTGGGATTACAAGGG - Intergenic
1096493408 12:52025319-52025341 CCAAACTGCTGGGATTACAGGGG + Intronic
1096708070 12:53435330-53435352 CCAAAGTGCTGGGATTACATGGG - Intergenic
1097988314 12:65807608-65807630 AAAGCTTGCTGGGGTTATATGGG - Intergenic
1100623825 12:96308466-96308488 CCAACGTGCTGGGATTACAGGGG - Intronic
1100819330 12:98416694-98416716 CCAAAGTGCTGGGATTACATGGG - Intergenic
1100988580 12:100228352-100228374 CCAAAGTGCTGGGATTACATGGG - Intronic
1101503343 12:105324945-105324967 ACAGCCTGGTGGAATTACTACGG + Intronic
1101953626 12:109195177-109195199 ACAGCCTCCTGCCATTGCATTGG - Intronic
1102314487 12:111875943-111875965 CCAAACTGCTGGGATTACAGGGG - Intronic
1102497247 12:113328287-113328309 CCAACGTGCTGGGATTACACAGG + Intronic
1102662144 12:114538566-114538588 CCATGCTGCTGGGATTACATGGG - Intergenic
1102887309 12:116531922-116531944 CCAGACTGCTGGGATTACAGGGG - Intergenic
1103262173 12:119596751-119596773 CCAGAGTGCTGGGATTACATGGG + Intronic
1103765551 12:123276920-123276942 CCAACATGCTGGGATTACAGGGG + Intergenic
1104179388 12:126363658-126363680 CCAAACTGCTGGGATTACAGGGG + Intergenic
1104772161 12:131370174-131370196 ACACCCTCCTGGGGTCACATTGG - Intergenic
1104852197 12:131882306-131882328 CCAGCATGCTGGGATTACACAGG + Intergenic
1105271656 13:18882043-18882065 CCAGAGTGCTGGGATTACAGGGG - Intergenic
1105432926 13:20353537-20353559 CCAACGTGCTGGGATTACAGGGG - Intergenic
1105454014 13:20524635-20524657 CCAACGTGCTGGGATTACAGGGG + Intronic
1108397857 13:50007524-50007546 CCAAACTGCTGGGATTACAGGGG - Intronic
1108960043 13:56215238-56215260 ACAGCCATCCTGGATTACATGGG + Intergenic
1110029557 13:70589980-70590002 CCAGAGTGCTGGGATTACAGGGG + Intergenic
1110691349 13:78432665-78432687 CCAAACTGCTGGGATTACAGGGG + Intergenic
1112037165 13:95507524-95507546 CCAAGGTGCTGGGATTACATAGG - Intronic
1114326748 14:21596712-21596734 CCAGAGTGCTGGGATTACAGGGG + Intergenic
1114431349 14:22664375-22664397 AAAGCCTACTGGGATTAAAAGGG - Intergenic
1115288231 14:31741438-31741460 CCAGCCTGCTGGGTTTATATCGG - Intronic
1115820632 14:37209396-37209418 CCAAAGTGCTGGGATTACATGGG - Intronic
1115979434 14:39033534-39033556 ATAGGCTGATGGGATCACATAGG + Intronic
1116484010 14:45424970-45424992 CCAGAGTGCTGGGATTACAGGGG + Intergenic
1117227227 14:53674578-53674600 ACAAAGTGCTGGGATTACAGGGG - Intergenic
1118241719 14:64066237-64066259 CCAAAGTGCTGGGATTACATAGG - Intronic
1118332128 14:64823085-64823107 AGAGCCTGCTGACATGACATCGG - Exonic
1119226881 14:72951239-72951261 CCAAAGTGCTGGGATTACATAGG + Intronic
1119921889 14:78454392-78454414 ACAGCCTTTTGGGATTTCTTAGG - Intronic
1120019627 14:79513862-79513884 ACAGCCTGCTGGCAGTACCTAGG + Intronic
1120401961 14:84043473-84043495 ACAGCCTGCTGGGGTTAAGGGGG + Intergenic
1121089521 14:91171468-91171490 ACAGCCATCTGGGATTCCATTGG + Intronic
1121961090 14:98260437-98260459 CCAAACTGCTGGGATTACAGGGG + Intergenic
1122194149 14:100072493-100072515 CCAAAGTGCTGGGATTACATGGG + Intronic
1122702848 14:103601890-103601912 CCAAAGTGCTGGGATTACATGGG - Intronic
1122747457 14:103907271-103907293 ACAAAGTGCTGGGATTACAGGGG - Intergenic
1123437109 15:20262621-20262643 CCAAAGTGCTGGGATTACATAGG + Intergenic
1124174796 15:27414385-27414407 ACAGCCTGGAGGGGTTTCATTGG + Intronic
1124347942 15:28934825-28934847 ACACCTTGCTGTGATTACTTTGG + Intronic
1124831960 15:33157729-33157751 CCAACGTGCTGGGATTACAGGGG - Intronic
1125711215 15:41788214-41788236 CCAGAGTGCTGGGATTACAGGGG + Intronic
1125847027 15:42865560-42865582 ACAAAGTGCTGGGATTACAAGGG - Intronic
1125949832 15:43742898-43742920 CCAGAGTGCTGGGATTACAGGGG - Intergenic
1126068398 15:44844304-44844326 CCAGAGTGCTGGGATTACATAGG - Intergenic
1126090433 15:45046501-45046523 CCAGAGTGCTGGGTTTACATAGG + Intronic
1126131228 15:45343448-45343470 ACAAAGTGCTGGGATTACAGGGG + Intergenic
1127251119 15:57239398-57239420 CCAAGCAGCTGGGATTACATAGG - Intronic
1127385234 15:58461676-58461698 CCAGAATGCTGGGATTACAGGGG + Intronic
1127600868 15:60535397-60535419 AGAGCCTGCTTGAATTACACAGG - Intronic
1127639296 15:60900611-60900633 CCAGAGTGCTGGGATTACAGGGG - Intronic
1127966692 15:63928006-63928028 CCAAAATGCTGGGATTACATGGG + Intronic
1128113553 15:65091539-65091561 CCAAAGTGCTGGGATTACATGGG + Intergenic
1129485203 15:75863898-75863920 CCAGAGTGCTGGGATTACAGGGG + Intronic
1129802066 15:78422606-78422628 ACAGAGTGCTGGGATTTCAGGGG - Intergenic
1131304260 15:91227247-91227269 ACAGCCTGCAGGGACTCCACGGG - Intronic
1132217528 15:100077181-100077203 CCAAACTGCTGGGATTACAGGGG - Intronic
1133008117 16:2895970-2895992 ACAGCCTGCTGTCATAACAGGGG + Intronic
1133204508 16:4225320-4225342 ACCGAGTGCTGGGATTACAGGGG - Intronic
1133614147 16:7460313-7460335 ACAGACTTCTGGTATTTCATTGG + Intronic
1135531544 16:23258915-23258937 CCAAAGTGCTGGGATTACATGGG + Intergenic
1135999830 16:27283941-27283963 TCAAAGTGCTGGGATTACATGGG - Intronic
1136245424 16:28973195-28973217 CCACCGTGCTGGGATTACAGGGG - Intergenic
1136847459 16:33588211-33588233 CCAAAGTGCTGGGATTACATAGG - Intergenic
1137348184 16:47684504-47684526 CCAGAGTGCTGGGATTACAGGGG - Intronic
1139542522 16:67628932-67628954 TCAGCCTCCTGGGAGTACAGGGG - Intronic
1139776143 16:69318231-69318253 CCAGAGTGCTGGGATTACAGGGG + Intronic
1139912392 16:70406181-70406203 CCAGAGTGCTGGGATTACAGGGG - Intronic
1140035319 16:71367401-71367423 ACACCCTTCTAGGATGACATCGG - Intronic
1140823272 16:78682616-78682638 ACAGACTGCTGGGATTACAGGGG - Intronic
1203109167 16_KI270728v1_random:1436866-1436888 CCAAAGTGCTGGGATTACATAGG - Intergenic
1142574644 17:898467-898489 GCAGGGTGCTGGGATTACAGGGG - Intronic
1143114500 17:4574999-4575021 ACAGCCTGCAGGGAACAGATTGG - Intergenic
1143161168 17:4872376-4872398 CCAAACTGCTGGGATTACAGGGG - Intronic
1144005104 17:11092725-11092747 CCAAACTGCTGGGATTACAGGGG - Intergenic
1146217788 17:30992190-30992212 CCAATCTGCTGGGATTACACAGG + Intronic
1146219460 17:31005591-31005613 CCAGAGTGCTGGGATTACAGGGG + Intergenic
1146304401 17:31719806-31719828 CCAGAGTGCTGGGATTACAGGGG - Intergenic
1146392889 17:32439252-32439274 CCAAAGTGCTGGGATTACATGGG - Intergenic
1147203738 17:38822026-38822048 CCAAACTGCTGGGATTACAGGGG + Intronic
1148646158 17:49220582-49220604 CCAAACTGCTGGGATTACAGGGG - Intronic
1149018213 17:51933286-51933308 AAAGACTTCTGTGATTACATTGG - Intronic
1149462986 17:56848416-56848438 CCAAAGTGCTGGGATTACATGGG + Intronic
1151035271 17:70791948-70791970 ACAGCCAGGTGGAAGTACATAGG + Intergenic
1151312308 17:73300784-73300806 CCAGAGTGCTGGGATTACAGGGG - Intronic
1151316807 17:73327942-73327964 CCAGAGTGCTGGGATTACAGAGG - Intergenic
1151993023 17:77590630-77590652 CCAGAGTGCTGGGATTACAGGGG + Intergenic
1152764033 17:82126018-82126040 CCAGAGTGCTGGGATTACAGGGG - Intronic
1153129604 18:1840191-1840213 CCAAACTGCTGGGATTACAAGGG - Intergenic
1153745407 18:8173806-8173828 CCAGAGTGCTGGGATTACAGGGG - Intronic
1154150109 18:11899949-11899971 CCAAACTGCTGGGATTACAGGGG - Intronic
1154950317 18:21203262-21203284 CCAGTGTGCTGGGATTACAGGGG + Intergenic
1155480908 18:26286457-26286479 ACAACCAGCTGGGATTCCACAGG + Exonic
1157242009 18:46019538-46019560 GCAACGTGCTGGGATTACAGGGG - Intronic
1158136630 18:54214998-54215020 CCAAACTGCTGGGATTACAGGGG + Intronic
1158892285 18:61883957-61883979 ACAGCCTTCAGCGTTTACATGGG - Intronic
1160928284 19:1557302-1557324 CCAAAGTGCTGGGATTACATGGG - Intronic
1161144034 19:2666431-2666453 CCAACGTCCTGGGATTACATAGG + Intronic
1161332137 19:3693431-3693453 ACAGCCTGAGGGGATTAGCTCGG - Intronic
1161787567 19:6336913-6336935 CCAGAGTGCTGGGATTACAGGGG - Intergenic
1161953215 19:7478930-7478952 AGAGCCTGCTGGGAGCACAGAGG - Intronic
1162009991 19:7807231-7807253 CCAACGTGCTGGGATTACAGTGG + Intergenic
1162331715 19:10033893-10033915 ACAGCCTCCTGGGGTCACAAAGG - Intergenic
1162650165 19:12082311-12082333 CCAAAGTGCTGGGATTACATGGG + Intergenic
1162672419 19:12268095-12268117 CCAAAGTGCTGGGATTACATGGG + Intronic
1163072033 19:14851721-14851743 CCAGTGTGCTGGGATTACAGGGG + Intergenic
1163136983 19:15319070-15319092 CCAGACTGCTGGGATTACACAGG - Intronic
1163259161 19:16176758-16176780 TCAAAATGCTGGGATTACATGGG + Intergenic
1163384915 19:16993665-16993687 GAAGCCTGCTGGGATTCCAGTGG - Intronic
1163612111 19:18307047-18307069 ACAGCCTGCAGGGTTTCCTTGGG - Exonic
1163870958 19:19821157-19821179 CCAACGTGCTGGGATTACAGGGG + Intronic
1165689432 19:37851815-37851837 ACAAAATGCTGGGATTACAGGGG + Intergenic
1165837023 19:38764634-38764656 TCAAACTGCTGGGATTACAGAGG - Intronic
1165863025 19:38918946-38918968 CCAAAGTGCTGGGATTACATGGG - Intronic
1165934810 19:39382918-39382940 ACAGCCTGCTGTGACTACTCTGG - Intronic
1166811430 19:45516736-45516758 ACAAAGTGCTGGGATTACAGGGG - Intronic
1167968920 19:53173631-53173653 CCAAACTGCTGGGATTACAGGGG + Intronic
925507679 2:4586275-4586297 ACAGCCTGCTGGGGTTTGATAGG + Intergenic
925874590 2:8301105-8301127 ACAGGATCCTGGGATTACAAAGG - Intergenic
926160563 2:10486545-10486567 ACAGCCTGCTTGGAGTTCAGTGG + Intergenic
929217360 2:39429409-39429431 ACAGCCTGCTGGGATTGTGTGGG - Intronic
929906046 2:46047461-46047483 ACAGCCTGCTGGGAGGGCAGAGG - Intronic
930716830 2:54601239-54601261 ACAGCCATCTTGGATTATATAGG + Intronic
931163170 2:59716672-59716694 CCAAACTGCTGGGATTACAGAGG + Intergenic
933021308 2:77196481-77196503 CCACAGTGCTGGGATTACATGGG - Intronic
933384620 2:81594130-81594152 AGAACCTGCTGGCATGACATGGG + Intergenic
934910280 2:98246640-98246662 CCAGAGTGCTGGGATTACAAGGG + Intronic
936348177 2:111691020-111691042 ACACCCTGCTGGGGTAACACTGG + Intergenic
937376233 2:121337603-121337625 CCAGAATGCTAGGATTACATGGG + Intergenic
937386898 2:121442737-121442759 CCAAACTGCTGGGATTACAGGGG + Intronic
937865187 2:126745639-126745661 CCAAACTGCTGGGATTACAGGGG + Intergenic
938300548 2:130208261-130208283 CCAGAGTGCTGGGATTACAGGGG - Intergenic
938456178 2:131466210-131466232 CCAGAGTGCTGGGATTACAGGGG + Intronic
940255366 2:151722807-151722829 CCAAACTGCTGGGATTACAGGGG + Intronic
941032656 2:160530648-160530670 ACAAAGTGCTGGGATTACAGAGG - Intergenic
941456609 2:165717044-165717066 CCATCGTGCTGGGATTACAGGGG - Intergenic
941899156 2:170661248-170661270 TCAAAGTGCTGGGATTACATGGG + Intergenic
943515829 2:188885522-188885544 CCAAAGTGCTGGGATTACATTGG - Intergenic
944252069 2:197588474-197588496 CCAGAGTGCTGGGATTACAGAGG + Intronic
944765062 2:202855813-202855835 CCAGAGTGCTGGGATTACAGGGG - Intronic
945051538 2:205828577-205828599 CCAGAGTGCTGGGATTACAGGGG - Intergenic
945823343 2:214691161-214691183 ACAAAGTGCTGGGATTACAGGGG - Intergenic
945966374 2:216191669-216191691 CCAGAGTGCTGGGATTACAGGGG + Intronic
946645146 2:221825590-221825612 CCAAAGTGCTGGGATTACATGGG - Intergenic
946955923 2:224929938-224929960 ACAGAGTGCTGGGATTACAGGGG - Intronic
947527972 2:230890983-230891005 CCAAACTGCTGGGATTACAGGGG - Intergenic
947885929 2:233571206-233571228 AAAGCCTGCTGGGATTTGGTTGG - Intergenic
948473292 2:238200557-238200579 CCAGAGTGCTGGGATTACAGTGG - Intronic
1168845525 20:941837-941859 TCAACATGCTGGGATTACAGGGG - Intergenic
1169123773 20:3112702-3112724 CCAGAGTGCTGGGATTACACTGG - Intronic
1169677593 20:8172041-8172063 ATAGCTTACTGGGATTACAGTGG - Intronic
1170881668 20:20302399-20302421 CCAAAGTGCTGGGATTACATGGG - Intronic
1172955102 20:38750889-38750911 CCAACATGCTGGGATTACAGGGG + Intronic
1173407754 20:42781338-42781360 GGTGTCTGCTGGGATTACATGGG - Intronic
1173872257 20:46349383-46349405 ACAGCCTCCTGGAACTTCATGGG - Intronic
1174199732 20:48798822-48798844 CCCTCCTGCTGGGATTAAATTGG + Intronic
1174554150 20:51382128-51382150 AAAGACTCCTGTGATTACATGGG - Intergenic
1174807223 20:53615205-53615227 CCAAACTGCTGGGATTACAGGGG + Intergenic
1175692087 20:61072868-61072890 ACAGCCTGGTGGGATGAGAAGGG - Intergenic
1176388485 21:6151475-6151497 AGGGCCTTCTGGGATGACATTGG - Intergenic
1176678159 21:9800710-9800732 CCAATGTGCTGGGATTACATGGG + Intergenic
1178953293 21:37003046-37003068 CCAAACTGCTGGGATTACAGGGG + Intergenic
1179734987 21:43386773-43386795 AGGGCCTTCTGGGATGACATTGG + Intergenic
1181571822 22:23772071-23772093 CCAAAGTGCTGGGATTACATGGG - Intronic
1181863010 22:25833945-25833967 ACAGTCAGCTGGGCTTACACAGG - Intronic
1183549265 22:38471701-38471723 CCAAAGTGCTGGGATTACATGGG - Intronic
1183876859 22:40789899-40789921 CCAAACTGCTGGGATTACAGGGG + Intronic
1183950897 22:41352498-41352520 AAAGGCTGGTGGGATTACAGGGG - Intronic
1183955579 22:41378730-41378752 CCAAAGTGCTGGGATTACATGGG + Intronic
1184122420 22:42460793-42460815 CCAAACTGCTGGGATTACAGGGG - Intergenic
1184905192 22:47478358-47478380 AAAGCCTGCTGGGATTATTATGG + Intronic
1184948289 22:47819992-47820014 ACCTCCTGCTGGGATCACCTGGG - Intergenic
1185353665 22:50352467-50352489 ACAAAGTGCTGGGATTACAGGGG - Intronic
950779655 3:15380355-15380377 CCAAAGTGCTGGGATTACATGGG - Intergenic
951025934 3:17829909-17829931 CCAGCATGCTGGAATTACAGGGG + Intronic
951348320 3:21573797-21573819 CCAGAGTGCTGGGATTACATGGG - Intronic
951644961 3:24879561-24879583 CCAGAGTGCTGGGATTACAGAGG - Intergenic
952789743 3:37190192-37190214 CCAAAGTGCTGGGATTACATGGG + Intergenic
952830599 3:37561640-37561662 AAAGCCTGGTGGGATCACAGGGG + Intronic
953995043 3:47513250-47513272 CCAAACTGCTGGGATTACAGGGG + Intronic
955322492 3:57984288-57984310 AGAGCCTGCTGTGATTACATGGG - Intergenic
956277810 3:67521877-67521899 CCAAACTGCTGGGATTACAGAGG + Intronic
958510762 3:95045032-95045054 ACTGCCTGCAGGTATTCCATGGG + Intergenic
958983535 3:100753550-100753572 TCAGAGTGCTGGGATTACACTGG + Intronic
960587361 3:119332458-119332480 CCAAAATGCTGGGATTACATAGG + Intronic
961185178 3:124908891-124908913 CCAGAGTGCTGGGATTACAGAGG - Intronic
961668902 3:128513045-128513067 CCAAACTGCTGGGATTACAGGGG - Intergenic
962025387 3:131541929-131541951 CCAAACTGCTGGGATTACAGGGG + Intronic
962651830 3:137502445-137502467 CCAGAGTGCTGGGATTACAGGGG - Intergenic
963112819 3:141700958-141700980 ACAGCCTGGTGGGCTTACCTGGG + Intergenic
963168849 3:142231333-142231355 CCAAACTGCTGGGATTACAGGGG - Intergenic
963182175 3:142369783-142369805 ACAAAGTGCTGGGATTACAGGGG - Intronic
966183467 3:177207540-177207562 CCAACATGCTGGGATTACAGGGG + Intergenic
966696092 3:182792484-182792506 CCAAAGTGCTGGGATTACATGGG + Intergenic
966740964 3:183233088-183233110 CCAGAGTGCTGGGATTACAGGGG - Intronic
968265845 3:197362828-197362850 CCAAACTGCTGGGATTACAGGGG + Intergenic
969828910 4:9780209-9780231 ACTGCCTGCTGGGAAGACAGAGG + Intronic
970783106 4:19762988-19763010 ACAAAATGCTGGGATTACAGGGG + Intergenic
971446329 4:26753367-26753389 CCAAAGTGCTGGGATTACATGGG - Intronic
971586922 4:28416120-28416142 CCAATATGCTGGGATTACATGGG + Intergenic
971613240 4:28753737-28753759 ACAGAGTGCAGGTATTACATTGG + Intergenic
971750250 4:30638100-30638122 CCAGACTGCTGGGATTATAGGGG - Intergenic
972283980 4:37630623-37630645 CCAAAGTGCTGGGATTACATGGG + Intronic
973052073 4:45609446-45609468 ACAGCCTGGTGGGCTTACCCGGG - Intergenic
973785816 4:54331909-54331931 TCAGCCTTCTAGGATTACTTAGG - Intergenic
974646247 4:64697114-64697136 ACAGAGTGCTGGGATTACAGGGG - Intergenic
974726100 4:65800174-65800196 ACATCCTGCTGGGATTCCCAAGG + Intergenic
974950372 4:68578659-68578681 ACAGCCTGGTGGGCTTACCTGGG - Intronic
975331192 4:73115548-73115570 CCAAACTGCTGGGATTACAAGGG + Intronic
975962877 4:79934266-79934288 ACAAAGTGCTGGGATTATATAGG - Intronic
976165206 4:82247424-82247446 AAAGGGTGCTCGGATTACATTGG - Intergenic
977214105 4:94258413-94258435 CCAGAGTGCTGGGATTACCTGGG + Intronic
977614387 4:99071812-99071834 ACAGCATTCTGGGCTTAAATAGG - Exonic
978446451 4:108785350-108785372 CCAAACTGCTGGGATTACAAGGG - Intergenic
978808630 4:112826568-112826590 ACAACCAGCTGGGATTCCACAGG + Intronic
978860497 4:113442967-113442989 TCAAAGTGCTGGGATTACATGGG + Intergenic
979018175 4:115461081-115461103 CCAACGTGCTGGGATTACAAGGG + Intergenic
979614727 4:122729685-122729707 CCAAACTGCTGGGATTACAGGGG - Intergenic
979908694 4:126332606-126332628 CCAGCATGCTGGGATTACAGGGG + Intergenic
982359153 4:154500151-154500173 AAGGCCCCCTGGGATTACATTGG - Intergenic
982722072 4:158869424-158869446 CCAGCCTGCTGGAGTTACCTTGG - Exonic
982934461 4:161453852-161453874 CCACAATGCTGGGATTACATGGG + Intronic
983391771 4:167141032-167141054 TCAGCCTGATGGGATTGCAGGGG - Intronic
985397366 4:189558086-189558108 CCAATGTGCTGGGATTACATGGG - Intergenic
986038644 5:3964844-3964866 CCAAAGTGCTGGGATTACATGGG - Intergenic
986494252 5:8326478-8326500 ATAGCCTGCTGGAGTTGCATTGG - Intergenic
986714760 5:10514892-10514914 CCAGAGTGCTGGGATTACAGTGG + Intronic
987713160 5:21530513-21530535 CCAACGTGCTGGGATTACAGGGG + Intergenic
988243281 5:28641763-28641785 CCAGAGTGCTGGGATTACAGGGG + Intergenic
988591401 5:32553025-32553047 ACTGCCTGCTGGGCTTAATTAGG - Intronic
990053937 5:51546105-51546127 ACAGCCTGTAGGGATAGCATAGG - Intergenic
990185027 5:53202783-53202805 ACAGCCTGTTGGGCTTACCTGGG - Intergenic
991342452 5:65626476-65626498 CCAAACTGCTGGGATTACAGGGG - Intronic
992492648 5:77259899-77259921 CCAAACTGCTGGGATTACAGAGG - Intronic
992619146 5:78575286-78575308 CCAAAGTGCTGGGATTACATGGG - Intronic
994569859 5:101502538-101502560 CCAAACTGCTGGGATTACATGGG - Intergenic
994629049 5:102259115-102259137 ACAGACTACTGGGATTAAAGAGG + Intronic
995922276 5:117328613-117328635 CCATCCCGCTGGGATTTCATAGG - Intergenic
997932858 5:138086476-138086498 CCAAAGTGCTGGGATTACATTGG + Intronic
997987540 5:138514984-138515006 CCAAAGTGCTGGGATTACATAGG + Intronic
999218107 5:149952951-149952973 CCAAAGTGCTGGGATTACATAGG - Intergenic
999718306 5:154379761-154379783 ACACCCTGCAGGGATGCCATAGG - Intronic
999987860 5:157021910-157021932 CCAAAGTGCTGGGATTACATGGG + Intergenic
1000295042 5:159906113-159906135 ACAAAGTGCTGGGATTACAGGGG + Intergenic
1001151718 5:169234666-169234688 CCAAAGTGCTGGGATTACATGGG + Intronic
1001233872 5:170013212-170013234 AGAGGCTGCTGGGAATAAATAGG + Intronic
1001234003 5:170014162-170014184 AGAGGCTGCTGGGAATAAATAGG + Intronic
1002531178 5:179846539-179846561 CCAGTGTGCTGGGATTACAGGGG + Intronic
1003124662 6:3346679-3346701 ACAGCCTCTTGGGAGTCCATGGG + Intronic
1003297591 6:4846501-4846523 AAAGCATGCTGGCATCACATGGG - Intronic
1003466746 6:6387464-6387486 ACAAAGTGCTGGGATTACAGGGG + Intergenic
1003919091 6:10815360-10815382 CCAGAGTGCTGGGATTACAGGGG - Intronic
1004663753 6:17732388-17732410 CCAAAGTGCTGGGATTACATAGG + Intergenic
1004916871 6:20340508-20340530 ACAGCATGCTGGGATCTCAATGG + Intergenic
1004977283 6:20982182-20982204 TCAGCCTCCTGAGATTACAGGGG + Intronic
1005625438 6:27658270-27658292 CCAAAGTGCTGGGATTACATGGG - Intergenic
1006345397 6:33477166-33477188 CCAAACTGCTGGGATTACAGGGG + Intergenic
1006486965 6:34351087-34351109 CCAGAGTGCTGGGATTACAGGGG - Intronic
1006791735 6:36705734-36705756 AAAGGCTGCTGTCATTACATTGG + Intronic
1006873276 6:37272646-37272668 CCAACGTGCTGGGATTACAGAGG + Intronic
1007015497 6:38462668-38462690 AATGCCTGCTGGGATTTTATTGG + Intronic
1009003562 6:57751389-57751411 CCAACGTGCTGGGATTACAGGGG - Intergenic
1009281107 6:61753057-61753079 ACAACCAGCTAGAATTACATTGG + Intronic
1010345369 6:74804094-74804116 CCAAACTGCTGGGATTACTTTGG - Intergenic
1011089944 6:83586106-83586128 ACAAAGTGCTGGGATTATATAGG + Intronic
1011561322 6:88619426-88619448 CCAAAGTGCTGGGATTACATGGG + Intronic
1012198972 6:96381488-96381510 ATACCCTACTGAGATTACATGGG + Intergenic
1012595601 6:101034842-101034864 CCAAACTGCTGGGATTACAGGGG - Intergenic
1013046374 6:106489556-106489578 CCAAAGTGCTGGGATTACATAGG - Intergenic
1013532564 6:111033545-111033567 ACAAAGTGCTGGGATTACAGGGG + Intergenic
1014237817 6:118979780-118979802 CCAAACTGCTGGGATTACAAGGG - Intronic
1015506979 6:133998799-133998821 CCAGAGTGCTGGGATTACAGAGG + Intronic
1016091941 6:139990394-139990416 GCAGCCTTCTGTGAGTACATTGG + Intergenic
1016095524 6:140032087-140032109 CCAAACTGCTGGGATTACAGGGG + Intergenic
1017466080 6:154694929-154694951 CCAACGTGCTGGGATTACAGGGG - Intergenic
1017614425 6:156229379-156229401 AGAGCCTGCTGGGACAACTTCGG + Intergenic
1017692577 6:156981648-156981670 AAAACCTGATGGGATTAGATGGG - Intronic
1017846784 6:158265419-158265441 CCAACGTGCTGGGATTACAGGGG - Intronic
1018577948 6:165279166-165279188 CCAAGCTGCTGGGATTACAGGGG - Intergenic
1018663987 6:166116849-166116871 AAAGACTGCTGGGATTTGATTGG + Intergenic
1018726207 6:166615115-166615137 ACATCCTGCTGGGATTTCAATGG - Intronic
1019324748 7:432575-432597 ACAGACTGCTGGGCTTGCAAAGG + Intergenic
1020594966 7:10195061-10195083 CCAAAATGCTGGGATTACATGGG + Intergenic
1020822338 7:12985609-12985631 ATAGCATGCGGGGATTACCTGGG + Intergenic
1020913537 7:14163730-14163752 ACAAAGTGCTGGGATTACAGGGG - Intronic
1020991391 7:15200751-15200773 ACAAAGTGCTGGGATTACAGGGG + Exonic
1021247352 7:18280189-18280211 CCAAACTGCTCGGATTACATGGG - Intronic
1021733379 7:23618813-23618835 CCAGAGTGCTGGGATTACAGGGG + Intronic
1022082168 7:27033621-27033643 CCAAAGTGCTGGGATTACATGGG + Intergenic
1024801081 7:53079621-53079643 ACACCCTGCTAGGATTTGATAGG - Intergenic
1025127150 7:56353431-56353453 CCAAAGTGCTGGGATTACATAGG + Intergenic
1025608055 7:63053709-63053731 TCAGCCTCCTGAGATTACCTGGG - Intergenic
1025871174 7:65435546-65435568 CCAAGCAGCTGGGATTACATGGG - Intergenic
1025999496 7:66550004-66550026 CCAAAGTGCTGGGATTACATGGG - Intergenic
1026074816 7:67156656-67156678 ACAGCCTTCTGGAAGAACATGGG + Intronic
1026093225 7:67318463-67318485 CCAGAGTGCTGGGATTACAGGGG - Intergenic
1026657987 7:72273769-72273791 CCAAAGTGCTGGGATTACATAGG + Intronic
1026702048 7:72655506-72655528 ACAGCCTTCTGGAAGAACATGGG - Intronic
1026718756 7:72812950-72812972 TCAACTTGCTGGGATTATATAGG + Intronic
1026844990 7:73693737-73693759 AGAGCCTGCTGGGAGAACACTGG + Intronic
1027454723 7:78375101-78375123 CCAAAGTGCTGGGATTACATGGG + Intronic
1027464654 7:78500826-78500848 ACAAAGTGCTGGGATTACAGGGG - Intronic
1027471364 7:78578375-78578397 ACATACTGATGGGTTTACATTGG - Intronic
1028617604 7:92786921-92786943 CCAGAGTGCTGGGATTACAGGGG - Intronic
1029244469 7:99188940-99188962 CCAACGTGCTGGGATTACAGGGG + Intronic
1029529628 7:101116804-101116826 ACAAAGTGCTGGGATTACAGGGG - Intergenic
1029560841 7:101301989-101302011 CCAGAGTGCTGGGATTACAGGGG + Intergenic
1029637905 7:101797525-101797547 CCAGAGTGCTGGGATTACAGGGG - Intergenic
1030028952 7:105351395-105351417 CCAGAGTGCTGGGATTACAGGGG - Intronic
1030044772 7:105485113-105485135 ACAAAGTGCTGGGATTACAGGGG + Intronic
1030456801 7:109785188-109785210 CCAGGGTGCTGGGATTACAGGGG - Intergenic
1030699891 7:112626696-112626718 CCAGAGTGCTGGGATTACAGGGG + Intergenic
1031744347 7:125474761-125474783 CCAAAGTGCTGGGATTACATAGG - Intergenic
1032136814 7:129286719-129286741 CCAGAGTGCTGGGATTACAGGGG + Intronic
1032502389 7:132409820-132409842 CCAGCCTGTTGGGACTACAGGGG - Intronic
1034123679 7:148651680-148651702 CCAGAGTGCTGGGATTACAAGGG + Intergenic
1034759602 7:153659032-153659054 ACAGCATGCTGGGATTTGAAGGG + Intergenic
1035065125 7:156098790-156098812 CCAACGTGCTGGGATTACAGGGG + Intergenic
1035163651 7:156970025-156970047 ACAAAGTGCTGGGATTACAGGGG - Exonic
1035719489 8:1781095-1781117 CCAACGTGCTGGGATTACGTCGG - Exonic
1036011729 8:4732898-4732920 CCAGCCTGCTGGGATGGCAGAGG + Intronic
1036026321 8:4913047-4913069 CCAAACTGCTGGGATTACAGGGG + Intronic
1037694804 8:21214202-21214224 CCAACGTGCTGGGATTACAGGGG + Intergenic
1037810633 8:22084647-22084669 CCAGAGTGCTGGGATTACAGGGG - Intergenic
1037858890 8:22390826-22390848 TCACACTGCTGGGATTACAGGGG + Intronic
1038175405 8:25177661-25177683 TCAAACTGCTGGGATTACAGGGG + Intergenic
1038281180 8:26166565-26166587 ACAAAGTGCTGGGATTACAGGGG - Intergenic
1038380264 8:27086414-27086436 ACAAAGTGCTGGGATTACAGGGG - Intronic
1038469917 8:27806528-27806550 AAAGCCTGTTGGGATTTTATTGG + Intronic
1038662255 8:29507366-29507388 CCAAACTGCTGGGATTACAGGGG + Intergenic
1039350165 8:36755432-36755454 TTAGCCTGCTGGGATCACAGAGG + Intergenic
1041086502 8:54261523-54261545 CCAAAGTGCTGGGATTACATGGG + Intergenic
1042158019 8:65865614-65865636 ACGGCCTGGTGGGCTTACCTGGG - Intergenic
1043100720 8:76041588-76041610 CCAACGTGCTGGGATTACAGAGG + Intergenic
1043208760 8:77483407-77483429 CCAGAGTGCTGGGATTACAGCGG + Intergenic
1043286025 8:78532644-78532666 CCAAAGTGCTGGGATTACATAGG - Intronic
1043465500 8:80502492-80502514 CCAACATGTTGGGATTACATGGG + Intronic
1043750349 8:83926576-83926598 CCAGCCTGCTGGCATTTCTTTGG - Intergenic
1043764594 8:84114295-84114317 CCAAGGTGCTGGGATTACATGGG + Intergenic
1045401422 8:101822699-101822721 TCTGCCTGCTGGAATTACAAAGG - Intronic
1046006856 8:108496548-108496570 CCAGAGTGCTGGGATTACAGGGG + Intergenic
1046020359 8:108657595-108657617 ACAAAGTGCTGGGATTACAGGGG - Intronic
1046344082 8:112900142-112900164 GCAGCCTGCTATGATTCCATGGG - Intronic
1046413184 8:113875968-113875990 CCAGAGTGCTGGGATTACAGGGG - Intergenic
1046430855 8:114125762-114125784 CCAAACTGCTGGGATTACAGAGG + Intergenic
1047030629 8:120875556-120875578 ACAGAGTGCTGGGATTACAGGGG + Intergenic
1048717285 8:137283760-137283782 ACAGGCTGGTGGGCTTACCTGGG - Intergenic
1054261346 9:62868568-62868590 CCAGAGTGCTGGGATTACAGGGG - Intergenic
1055123001 9:72684849-72684871 ACATCCTACAGGGATGACATGGG + Intronic
1057535301 9:95896682-95896704 CCAAAGTGCTGGGATTACATGGG + Intronic
1057762535 9:97888434-97888456 CCAAACTGCTGGGATTACAGGGG + Intergenic
1059215870 9:112561592-112561614 CCAGAGTGCTGGGATTACAGGGG - Intronic
1059908764 9:119019528-119019550 ACAAAGTGCTGGGATTACAGGGG - Intergenic
1060609971 9:124954903-124954925 CCAGTGTGCTGGGATTACAAGGG - Intronic
1060623631 9:125090731-125090753 CCAAACTGCTGGGATTACAGGGG + Intronic
1060731269 9:126038543-126038565 CCAGAGTGCTGGGATTACAGGGG - Intergenic
1060767520 9:126306221-126306243 CCAAAGTGCTGGGATTACATGGG + Intergenic
1061050777 9:128193446-128193468 ACAAAGTGCTGGGATTACAGGGG - Intronic
1061102336 9:128501658-128501680 CCAGAGTGCTGGGATTACAGGGG + Intergenic
1061206409 9:129166493-129166515 CCAAACTGCTGGGATTACAGGGG - Intergenic
1061792405 9:133065584-133065606 CCAACGTGCTGGGATTACAGGGG - Intronic
1061979878 9:134096009-134096031 ACAGGCAGCTGGGATTACAGGGG - Intergenic
1062148369 9:135003929-135003951 CCAGAGTGCTGGGATTACAGGGG + Intergenic
1062215641 9:135388216-135388238 CCAACGTGCTGGGATAACATGGG - Intergenic
1203663307 Un_KI270754v1:3202-3224 CCAATGTGCTGGGATTACATGGG + Intergenic
1185466136 X:355441-355463 ACAGCCTGCTGGGATTACATGGG - Intronic
1185637244 X:1561695-1561717 CCAGAGTGCTGGGATTACAGGGG + Intergenic
1185867015 X:3633133-3633155 TCAGCCTCCTGGGACTACAGAGG - Intronic
1186482296 X:9905113-9905135 TCAGAGTGCTGGGATTACAAGGG + Intronic
1187180087 X:16935912-16935934 CCAAAGTGCTGGGATTACATGGG - Intergenic
1187540483 X:20188334-20188356 CCAGAATGCTGGGATTACAGGGG + Intronic
1190256311 X:48765309-48765331 CCAGAGTGCTGGGATTACAGGGG - Intronic
1192946232 X:75967630-75967652 ACAGCCTGGTGGGCTTACCTGGG + Intergenic
1193698947 X:84740760-84740782 ACAGCCTGGTGGGCTTATCTGGG - Intergenic
1195318704 X:103703668-103703690 CCAAAGTGCTGGGATTACATGGG - Intergenic
1195441301 X:104901469-104901491 CCAGAGTGCTGGGATTACAGGGG + Intronic
1195797209 X:108663924-108663946 ACAAAGTGCTGGGATTACAGGGG - Intronic
1196678538 X:118446164-118446186 TCAGCCTCCTGGGATTACAGAGG - Intronic
1198634499 X:138680909-138680931 CCAAACTGCTGGGATTACAGGGG - Intronic
1199221243 X:145318183-145318205 ACAGCCTGTTGAGATTATAGAGG - Intergenic
1199575416 X:149308885-149308907 ACAGACTGCTGGAATTCCAAGGG + Intergenic
1199609533 X:149600924-149600946 ACAACCTGCTGGGGGTACTTTGG + Intronic
1199629583 X:149768430-149768452 ACAACCTGCTGGGGGTACTTTGG - Intergenic
1200159381 X:153997805-153997827 CCAGACAGCTGGGATTACAGGGG - Intergenic
1200267128 X:154652679-154652701 ACAGCCTGAGGGGATGAGATGGG - Intronic
1201306190 Y:12552547-12552569 CCAGAGTGCTGGGATTACAAGGG + Intergenic
1201613879 Y:15874042-15874064 ACAGGATCCTGTGATTACATTGG - Intergenic