ID: 1185466137

View in Genome Browser
Species Human (GRCh38)
Location X:355442-355464
Sequence GACAGCCTGCTGGGATTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 507
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 479}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185466137_1185466141 -10 Left 1185466137 X:355442-355464 CCATGTAATCCCAGCAGGCTGTC 0: 1
1: 0
2: 2
3: 25
4: 479
Right 1185466141 X:355455-355477 GCAGGCTGTCGTAGCAACGGAGG 0: 1
1: 0
2: 0
3: 3
4: 41
1185466137_1185466146 16 Left 1185466137 X:355442-355464 CCATGTAATCCCAGCAGGCTGTC 0: 1
1: 0
2: 2
3: 25
4: 479
Right 1185466146 X:355481-355503 CGGCTCTAAAATTCACACGGTGG 0: 1
1: 0
2: 0
3: 2
4: 25
1185466137_1185466142 -9 Left 1185466137 X:355442-355464 CCATGTAATCCCAGCAGGCTGTC 0: 1
1: 0
2: 2
3: 25
4: 479
Right 1185466142 X:355456-355478 CAGGCTGTCGTAGCAACGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 39
1185466137_1185466148 29 Left 1185466137 X:355442-355464 CCATGTAATCCCAGCAGGCTGTC 0: 1
1: 0
2: 2
3: 25
4: 479
Right 1185466148 X:355494-355516 CACACGGTGGGAACGAACAACGG 0: 1
1: 0
2: 0
3: 8
4: 85
1185466137_1185466143 -4 Left 1185466137 X:355442-355464 CCATGTAATCCCAGCAGGCTGTC 0: 1
1: 0
2: 2
3: 25
4: 479
Right 1185466143 X:355461-355483 TGTCGTAGCAACGGAGGGACCGG 0: 1
1: 0
2: 0
3: 0
4: 32
1185466137_1185466147 17 Left 1185466137 X:355442-355464 CCATGTAATCCCAGCAGGCTGTC 0: 1
1: 0
2: 2
3: 25
4: 479
Right 1185466147 X:355482-355504 GGCTCTAAAATTCACACGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 51
1185466137_1185466144 13 Left 1185466137 X:355442-355464 CCATGTAATCCCAGCAGGCTGTC 0: 1
1: 0
2: 2
3: 25
4: 479
Right 1185466144 X:355478-355500 GACCGGCTCTAAAATTCACACGG 0: 1
1: 0
2: 0
3: 10
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185466137 Original CRISPR GACAGCCTGCTGGGATTACA TGG (reversed) Intronic
901043477 1:6380338-6380360 CCCAACATGCTGGGATTACAGGG - Intronic
901284311 1:8064830-8064852 CCCAAACTGCTGGGATTACAAGG - Intergenic
901495853 1:9621406-9621428 GACAAGGTACTGGGATTACAAGG - Intergenic
901694428 1:10996098-10996120 CCCAGAGTGCTGGGATTACAGGG + Intergenic
901872153 1:12144519-12144541 CCCAGTGTGCTGGGATTACAGGG - Intergenic
902269451 1:15292828-15292850 CCCAAACTGCTGGGATTACAGGG - Intronic
902560756 1:17276073-17276095 CACAAAGTGCTGGGATTACAGGG - Intronic
902568940 1:17334056-17334078 GACATCCTGCAGGGATTAGGAGG - Intronic
902952605 1:19898205-19898227 CCCAAACTGCTGGGATTACAGGG + Intronic
903060535 1:20665658-20665680 GCCAATGTGCTGGGATTACAAGG + Intronic
903250709 1:22051564-22051586 CCCAAACTGCTGGGATTACAAGG - Intergenic
903278613 1:22237316-22237338 GAGAGCCTGGTGGGAGAACAAGG + Intergenic
903470516 1:23583837-23583859 CACAGCATGTTGGGATTACTAGG + Intronic
903672533 1:25045231-25045253 GACTGCTTTCTGGGATAACATGG - Intergenic
903854621 1:26329433-26329455 GCCAAAGTGCTGGGATTACAGGG + Intronic
904502718 1:30925148-30925170 CACAAAGTGCTGGGATTACAGGG + Intergenic
904523222 1:31112283-31112305 CACAAGTTGCTGGGATTACAGGG + Intergenic
904727818 1:32563270-32563292 CCCAAACTGCTGGGATTACAGGG - Intronic
905559231 1:38913235-38913257 CCCAAACTGCTGGGATTACAAGG + Intronic
905598504 1:39230000-39230022 CCCAAACTGCTGGGATTACAAGG + Intronic
906639114 1:47430965-47430987 CCCAGAGTGCTGGGATTACAAGG + Intergenic
907076181 1:51581182-51581204 CCCAAACTGCTGGGATTACAAGG + Intronic
908037782 1:60074277-60074299 AACAAAGTGCTGGGATTACAGGG - Intergenic
908696220 1:66844932-66844954 CCCAGAGTGCTGGGATTACAGGG - Intronic
909000948 1:70216690-70216712 CCCAAACTGCTGGGATTACAGGG + Intronic
909610050 1:77541905-77541927 GACAGGCAGCTGGGGTCACAGGG + Intronic
913480901 1:119288323-119288345 CACAAAGTGCTGGGATTACAGGG - Intergenic
913683754 1:121212387-121212409 CTCAGAGTGCTGGGATTACAGGG + Intronic
915034243 1:152909181-152909203 GCCAACCTGCTGGCTTTACAGGG + Intronic
915131000 1:153695461-153695483 CCCAAGCTGCTGGGATTACAGGG - Intergenic
915178769 1:154040277-154040299 CACAAGCAGCTGGGATTACAGGG - Intronic
915339885 1:155171157-155171179 CCCAGAGTGCTGGGATTACAGGG - Intronic
917118806 1:171627941-171627963 CCCAGAGTGCTGGGATTACAGGG - Intergenic
917864975 1:179185983-179186005 CCCAGAGTGCTGGGATTACAGGG - Intronic
918355928 1:183706592-183706614 CACAGCCTGGTGGGCTTACCTGG + Intronic
918546029 1:185684961-185684983 CCCAGACTACTGGGATTACAGGG + Intergenic
918899861 1:190401095-190401117 CACAAAGTGCTGGGATTACAGGG - Intronic
921814804 1:219551312-219551334 AACAGCCTTCTGGCATTTCATGG + Intergenic
922185518 1:223270818-223270840 CCCAACGTGCTGGGATTACAGGG + Intronic
922419706 1:225451317-225451339 GACAGACTGATGGGTGTACAAGG - Intergenic
922685988 1:227639160-227639182 CACAGCCTGGTGGGCTTACCTGG + Intronic
922914823 1:229248562-229248584 CACAAAGTGCTGGGATTACAGGG + Intergenic
923314657 1:232768115-232768137 CTCAGCCTCCTGAGATTACAGGG - Intergenic
923468983 1:234273413-234273435 GACAGACTGCTGGAATTGTAGGG - Intronic
923960018 1:239069962-239069984 GAGATCCTGCTGGAATAACAGGG - Intergenic
924191220 1:241554531-241554553 CACAAAGTGCTGGGATTACAGGG + Intronic
924495749 1:244586797-244586819 GACAGCCTGCTGGAAGGTCAGGG + Intronic
1063431302 10:5990805-5990827 CCCAACATGCTGGGATTACATGG + Intergenic
1064130473 10:12705199-12705221 CCCAACGTGCTGGGATTACAGGG - Intronic
1064136123 10:12752253-12752275 CCCAGAGTGCTGGGATTACAGGG + Intronic
1064278112 10:13925840-13925862 CCCAGAGTGCTGGGATTACAGGG + Intronic
1064433763 10:15292743-15292765 CCCAACATGCTGGGATTACAGGG + Intronic
1066407677 10:35134474-35134496 TCCAGAGTGCTGGGATTACAGGG + Intronic
1066581018 10:36882428-36882450 CCCAAACTGCTGGGATTACAGGG - Intergenic
1068898212 10:62232005-62232027 AACAGAATGCTGGTATTACAAGG + Intronic
1069826454 10:71257788-71257810 CACAGCCTGCAGTGATTCCAGGG - Intronic
1070046195 10:72839247-72839269 CACAAAGTGCTGGGATTACAGGG + Intronic
1070839571 10:79474468-79474490 TTCAGAGTGCTGGGATTACAGGG - Intergenic
1071767238 10:88681054-88681076 CCCAGAGTGCTGGGATTACAGGG + Intergenic
1071779744 10:88830668-88830690 GCCAGCCTGCTGGGATTTTCTGG - Intronic
1071989223 10:91083936-91083958 ACCAGAGTGCTGGGATTACAGGG + Intergenic
1074061922 10:109974288-109974310 CCCAGAGTGCTGGGATTACAGGG - Intergenic
1075079783 10:119375645-119375667 GACTGCCTGCTGGGTAGACATGG + Intronic
1075695550 10:124432328-124432350 CCCAAACTGCTGGGATTACAGGG - Intergenic
1075768619 10:124914947-124914969 TCCAAACTGCTGGGATTACAAGG + Intergenic
1076668678 10:132107152-132107174 CCCAACATGCTGGGATTACAGGG + Intronic
1077317940 11:1927577-1927599 GATAGCCTGTGGGGATGACAGGG + Intronic
1077891800 11:6423620-6423642 CACAAAGTGCTGGGATTACAGGG + Intergenic
1078147788 11:8733740-8733762 GAAAGCATGCTGGGATCAGATGG - Intronic
1080830727 11:35891066-35891088 CCCAGTGTGCTGGGATTACAGGG + Intergenic
1080848741 11:36049093-36049115 GAGAGCATGCTGGAATGACAGGG - Intronic
1080884675 11:36355820-36355842 CCCAGAGTGCTGGGATTACAGGG + Intronic
1081799756 11:45849880-45849902 CCCAAACTGCTGGGATTACAGGG + Intronic
1081803428 11:45875559-45875581 GTCAGCCTACTGGGATTTTAAGG + Intronic
1081903147 11:46647017-46647039 CTCAGAGTGCTGGGATTACAGGG + Intronic
1083070554 11:59975403-59975425 GCCAAAATGCTGGGATTACAAGG + Intergenic
1083467361 11:62857381-62857403 CCCAAACTGCTGGGATTACAGGG + Intronic
1083788245 11:64966672-64966694 CCCAGAGTGCTGGGATTACAAGG - Intronic
1083957636 11:65994127-65994149 CACAAAGTGCTGGGATTACAAGG - Intergenic
1084552468 11:69854118-69854140 GGGAGAGTGCTGGGATTACAGGG - Intergenic
1084673673 11:70622161-70622183 GACATCCTGCTGGGTTTGGATGG - Intronic
1084705518 11:70814062-70814084 GCCAAAGTGCTGGGATTACAGGG - Intronic
1087013774 11:93537250-93537272 GCCAGGCTCCTGGGATTGCAGGG + Intronic
1087887783 11:103499928-103499950 CTCAGAGTGCTGGGATTACAGGG - Intergenic
1088280138 11:108127073-108127095 CCCAAACTGCTGGGATTACAGGG + Intronic
1088281345 11:108138242-108138264 CCCAGAGTGCTGGGATTACAGGG + Intronic
1088937624 11:114419526-114419548 GACAGCCAGCTGGAAATACAGGG + Intronic
1090005637 11:123000072-123000094 TCCAGAGTGCTGGGATTACAGGG - Intergenic
1091650587 12:2306167-2306189 GACAGCCTGCTAGGATGTGAAGG + Intronic
1092825557 12:12395544-12395566 CCCAGCGTGCCGGGATTACAGGG + Intronic
1093619791 12:21275679-21275701 CCCAGTGTGCTGGGATTACAGGG - Intronic
1096099490 12:48960933-48960955 GACAGCATGGTGGGATAACCTGG - Intergenic
1096126616 12:49124261-49124283 CCCAAACTGCTGGGATTACAAGG - Intergenic
1096493406 12:52025318-52025340 CCCAAACTGCTGGGATTACAGGG + Intronic
1096685555 12:53286195-53286217 GACAGACTGCTGTGAGGACAGGG - Exonic
1098214535 12:68201309-68201331 GACAGCATGCTAGAATTTCATGG - Intergenic
1100223700 12:92534853-92534875 GCCAGCGTGGTGGGATTTCAGGG + Intergenic
1100326597 12:93545311-93545333 TGCAGCCTGCTGGGATTTCCAGG + Intergenic
1100623827 12:96308467-96308489 CCCAACGTGCTGGGATTACAGGG - Intronic
1102314489 12:111875944-111875966 CCCAAACTGCTGGGATTACAGGG - Intronic
1102662146 12:114538567-114538589 CCCATGCTGCTGGGATTACATGG - Intergenic
1102844972 12:116170858-116170880 CCCAGAGTGCTGGGATTACAGGG + Intronic
1102887311 12:116531923-116531945 CCCAGACTGCTGGGATTACAGGG - Intergenic
1103262171 12:119596750-119596772 CCCAGAGTGCTGGGATTACATGG + Intronic
1103765549 12:123276919-123276941 CCCAACATGCTGGGATTACAGGG + Intergenic
1104179386 12:126363657-126363679 CCCAAACTGCTGGGATTACAGGG + Intergenic
1105044615 12:132991886-132991908 CCCAGAGTGCTGGGATTACAGGG - Intronic
1105271658 13:18882044-18882066 CCCAGAGTGCTGGGATTACAGGG - Intergenic
1105432928 13:20353538-20353560 CCCAACGTGCTGGGATTACAGGG - Intergenic
1105454012 13:20524634-20524656 CCCAACGTGCTGGGATTACAGGG + Intronic
1106535866 13:30642218-30642240 CCCAGTGTGCTGGGATTACAAGG + Intronic
1107162628 13:37249414-37249436 GCCAAAGTGCTGGGATTACAGGG + Intergenic
1107726446 13:43304422-43304444 GCTAGCCTGGTGGCATTACATGG - Intronic
1108397859 13:50007525-50007547 CCCAAACTGCTGGGATTACAGGG - Intronic
1108721734 13:53139325-53139347 GACAGGCTGCTGGGATTGCTGGG + Intergenic
1110029555 13:70589979-70590001 CCCAGAGTGCTGGGATTACAGGG + Intergenic
1110691347 13:78432664-78432686 CCCAAACTGCTGGGATTACAGGG + Intergenic
1112038894 13:95525749-95525771 CCCAGAGTGCTGGGATTACAGGG + Intronic
1112988709 13:105484367-105484389 TGTAGCTTGCTGGGATTACAGGG + Intronic
1113467453 13:110522316-110522338 CCCAACATGCTGGGATTACAGGG - Intergenic
1113732088 13:112648845-112648867 CACAAAGTGCTGGGATTACAGGG + Intronic
1114326746 14:21596711-21596733 TCCAGAGTGCTGGGATTACAGGG + Intergenic
1114431350 14:22664376-22664398 TAAAGCCTACTGGGATTAAAAGG - Intergenic
1116484008 14:45424969-45424991 CCCAGAGTGCTGGGATTACAGGG + Intergenic
1116572185 14:46532225-46532247 CCCAGAGTGCTGGGATTACAGGG + Intergenic
1116635869 14:47394891-47394913 CCCAGATTGCTGGGATTACAGGG - Intronic
1116775134 14:49170890-49170912 CCCAAACTGCTGGGATTACAGGG - Intergenic
1117227228 14:53674579-53674601 CACAAAGTGCTGGGATTACAGGG - Intergenic
1117684126 14:58236287-58236309 CCCAAACTGCTGGGATTACAGGG - Intronic
1118596933 14:67442958-67442980 CCCAAACTGCTGGGATTACAGGG - Intergenic
1118887045 14:69876224-69876246 GTCAAAGTGCTGGGATTACAGGG + Intronic
1120401960 14:84043472-84043494 CACAGCCTGCTGGGGTTAAGGGG + Intergenic
1121372342 14:93371128-93371150 CACAAAGTGCTGGGATTACAGGG - Intronic
1121961088 14:98260436-98260458 CCCAAACTGCTGGGATTACAGGG + Intergenic
1122179163 14:99943210-99943232 GACAGCCTGCAGGGAAAGCAGGG + Intergenic
1122512445 14:102280468-102280490 TCCAACGTGCTGGGATTACAAGG + Intronic
1122747458 14:103907272-103907294 CACAAAGTGCTGGGATTACAGGG - Intergenic
1122940451 14:104978703-104978725 GGCAGCCTGCGGGGACAACAGGG + Intergenic
1123951650 15:25284368-25284390 GCCAAAGTGCTGGGATTACAGGG - Intergenic
1124464461 15:29924328-29924350 CCCAACATGCTGGGATTACACGG + Intronic
1124470937 15:29985214-29985236 GCCAGCCTGTTGGGATTGTAGGG - Intergenic
1124831962 15:33157730-33157752 CCCAACGTGCTGGGATTACAGGG - Intronic
1125052502 15:35316996-35317018 TACAAACAGCTGGGATTACAGGG - Intronic
1125390657 15:39189281-39189303 AACAGCCTTGTGGGATTAGAAGG + Intergenic
1125448202 15:39780845-39780867 GTCAAAGTGCTGGGATTACAGGG + Intronic
1125665472 15:41426964-41426986 GCCAAGCAGCTGGGATTACAGGG + Intronic
1125711213 15:41788213-41788235 CCCAGAGTGCTGGGATTACAGGG + Intronic
1125847028 15:42865561-42865583 CACAAAGTGCTGGGATTACAAGG - Intronic
1125862337 15:43010711-43010733 CCCAGAGTGCTGGGATTACAAGG - Intronic
1125949834 15:43742899-43742921 CCCAGAGTGCTGGGATTACAGGG - Intergenic
1126131227 15:45343447-45343469 CACAAAGTGCTGGGATTACAGGG + Intergenic
1126588120 15:50310717-50310739 CCCAGACTGCTGGGATTACAGGG - Intronic
1127385232 15:58461675-58461697 CCCAGAATGCTGGGATTACAGGG + Intronic
1127639298 15:60900612-60900634 CCCAGAGTGCTGGGATTACAGGG - Intronic
1128038958 15:64552905-64552927 CCCAGAGTGCTGGGATTACAGGG + Intronic
1129485201 15:75863897-75863919 CCCAGAGTGCTGGGATTACAGGG + Intronic
1129802067 15:78422607-78422629 CACAGAGTGCTGGGATTTCAGGG - Intergenic
1130390285 15:83448204-83448226 GACAGCCTGCAGGGGAGACACGG + Intronic
1131304261 15:91227248-91227270 AACAGCCTGCAGGGACTCCACGG - Intronic
1131512138 15:93055360-93055382 GCCAGCCAGCTGGGACTTCACGG - Intronic
1131969833 15:97880716-97880738 GCCAGCTAGCTGGGATCACAGGG - Intergenic
1132217530 15:100077182-100077204 CCCAAACTGCTGGGATTACAGGG - Intronic
1133008116 16:2895969-2895991 AACAGCCTGCTGTCATAACAGGG + Intronic
1133204509 16:4225321-4225343 CACCGAGTGCTGGGATTACAGGG - Intronic
1136245426 16:28973196-28973218 CCCACCGTGCTGGGATTACAGGG - Intergenic
1137055369 16:35743670-35743692 GACAGCCTTCTGGGCTTTCAGGG + Intergenic
1137348186 16:47684505-47684527 CCCAGAGTGCTGGGATTACAGGG - Intronic
1137615738 16:49845873-49845895 AGCAGCCTGCTGGGCTTCCAGGG - Intronic
1138799561 16:60011516-60011538 CCCAGAGTGCTGGGATTACAGGG - Intergenic
1139485653 16:67255310-67255332 GACAGACTGCTGGGAGAGCAGGG - Intronic
1139542523 16:67628933-67628955 CTCAGCCTCCTGGGAGTACAGGG - Intronic
1139776141 16:69318230-69318252 CCCAGAGTGCTGGGATTACAGGG + Intronic
1139912394 16:70406182-70406204 GCCAGAGTGCTGGGATTACAGGG - Intronic
1140336261 16:74107769-74107791 TCCAACATGCTGGGATTACATGG + Intergenic
1140823273 16:78682617-78682639 CACAGACTGCTGGGATTACAGGG - Intronic
1141279658 16:82619781-82619803 GACAGTCAGCTTGGATTAGATGG + Intergenic
1141371331 16:83488882-83488904 CCCAGTGTGCTGGGATTACAGGG + Intronic
1142574645 17:898468-898490 GGCAGGGTGCTGGGATTACAGGG - Intronic
1142619798 17:1157734-1157756 GACAGCCTGGTGGGATCAGCAGG + Intronic
1143161170 17:4872377-4872399 CCCAAACTGCTGGGATTACAGGG - Intronic
1144005106 17:11092726-11092748 CCCAAACTGCTGGGATTACAGGG - Intergenic
1144019557 17:11228370-11228392 GGCAAAGTGCTGGGATTACAGGG - Intergenic
1144672454 17:17140619-17140641 GCCAGACTGCTGGGACCACAGGG + Intronic
1145292507 17:21559711-21559733 CCCAAACTGCTGGGATTACAGGG - Intronic
1146219458 17:31005590-31005612 CCCAGAGTGCTGGGATTACAGGG + Intergenic
1146227186 17:31077409-31077431 GCCAAAGTGCTGGGATTACAGGG - Intergenic
1146276579 17:31519851-31519873 CCCAAACTGCTGGGATTACAAGG - Intronic
1146304403 17:31719807-31719829 CCCAGAGTGCTGGGATTACAGGG - Intergenic
1146485073 17:33236092-33236114 CCCAGAGTGCTGGGATTACAGGG + Intronic
1146563774 17:33894264-33894286 GAAAGCCTGCTGGGCTTATGGGG + Intronic
1146963868 17:37008602-37008624 CCCACACTGCTGGGATTACAGGG - Intronic
1147203736 17:38822025-38822047 CCCAAACTGCTGGGATTACAGGG + Intronic
1148350466 17:46938120-46938142 CCCAGAGTGCTGGGATTACAGGG + Intronic
1148646160 17:49220583-49220605 CCCAAACTGCTGGGATTACAGGG - Intronic
1148874367 17:50677976-50677998 GAGAGCCTGCTGGGAATTCCTGG - Intronic
1149177404 17:53889881-53889903 CCCAGAATGCTGGGATTACAGGG - Intergenic
1149291693 17:55224093-55224115 GTCAAAGTGCTGGGATTACAGGG - Intergenic
1151312310 17:73300785-73300807 CCCAGAGTGCTGGGATTACAGGG - Intronic
1151993021 17:77590629-77590651 CCCAGAGTGCTGGGATTACAGGG + Intergenic
1152404728 17:80090525-80090547 ACCAGCGTGCTGTGATTACATGG - Intronic
1152764035 17:82126019-82126041 CCCAGAGTGCTGGGATTACAGGG - Intronic
1153129606 18:1840192-1840214 TCCAAACTGCTGGGATTACAAGG - Intergenic
1153745409 18:8173807-8173829 CCCAGAGTGCTGGGATTACAGGG - Intronic
1154150111 18:11899950-11899972 CCCAAACTGCTGGGATTACAGGG - Intronic
1154341098 18:13503029-13503051 GAGAGGCTGATGGTATTACATGG + Intronic
1154950315 18:21203261-21203283 CCCAGTGTGCTGGGATTACAGGG + Intergenic
1156505726 18:37590399-37590421 GCTAGCCTGCTGGGAGTATATGG + Intergenic
1157242010 18:46019539-46019561 CGCAACGTGCTGGGATTACAGGG - Intronic
1157825966 18:50812902-50812924 GACTGCCTGCTGGAATTACTTGG - Intronic
1157919255 18:51698480-51698502 CACAGCCTGGTGGGCTTACCTGG - Intergenic
1158136628 18:54214997-54215019 ACCAAACTGCTGGGATTACAGGG + Intronic
1158466700 18:57696999-57697021 GCCAAATTGCTGGGATTACAGGG - Intronic
1158924070 18:62232453-62232475 GACAACATGATGGGATTACTGGG - Intronic
1159330758 18:66991540-66991562 GCCAAAGTGCTGGGATTACAGGG - Intergenic
1159509035 18:69372434-69372456 CCCAACGTGCTGGGATTACAGGG - Intergenic
1161787569 19:6336914-6336936 CCCAGAGTGCTGGGATTACAGGG - Intergenic
1162514795 19:11141554-11141576 GCCAAAGTGCTGGGATTACAGGG + Intronic
1163072031 19:14851720-14851742 CCCAGTGTGCTGGGATTACAGGG + Intergenic
1163356928 19:16819183-16819205 CCCAGTGTGCTGGGATTACATGG + Intergenic
1163530419 19:17845520-17845542 GTCAAAGTGCTGGGATTACAAGG - Intronic
1163568784 19:18067961-18067983 GCCAAAGTGCTGGGATTACAGGG + Intronic
1163612112 19:18307048-18307070 GACAGCCTGCAGGGTTTCCTTGG - Exonic
1163870956 19:19821156-19821178 CCCAACGTGCTGGGATTACAGGG + Intronic
1165050307 19:33137209-33137231 CCCAGAATGCTGGGATTACAGGG + Intronic
1165083767 19:33328370-33328392 CAATGCCTGTTGGGATTACAGGG + Intergenic
1165300637 19:34966331-34966353 GCCAAAGTGCTGGGATTACAGGG - Intergenic
1165456927 19:35917546-35917568 CACAAAGTGCTGGGATTACAGGG - Intergenic
1165689431 19:37851814-37851836 CACAAAATGCTGGGATTACAGGG + Intergenic
1165838244 19:38772167-38772189 CCCAGAGTGCTGGGATTACAGGG - Intronic
1165841317 19:38790530-38790552 CCCAGAGTGCTGGGATTACAGGG + Intronic
1166811431 19:45516737-45516759 CACAAAGTGCTGGGATTACAGGG - Intronic
1167875343 19:52407514-52407536 CACAAAGTGCTGGGATTACAGGG - Intronic
1167968918 19:53173630-53173652 CCCAAACTGCTGGGATTACAGGG + Intronic
925794506 2:7527674-7527696 GAGAGCTTGCTGGGGATACAGGG - Intergenic
926013937 2:9431808-9431830 CCCAGAGTGCTGGGATTACAGGG + Intronic
926513848 2:13816228-13816250 CCCAACGTGCTGGGATTACAGGG - Intergenic
928191434 2:29173519-29173541 GAAAGCCTGCTGGTATAAGATGG + Intronic
929217361 2:39429410-39429432 CACAGCCTGCTGGGATTGTGTGG - Intronic
930486091 2:52013102-52013124 CCCAAACTGCTGGGATTACAGGG + Intergenic
931268573 2:60682035-60682057 CCCAGAGTGCTGGGATTACAGGG + Intergenic
931347807 2:61462599-61462621 CCCAGAGTGCTGGGATTACAGGG - Intronic
932241987 2:70164385-70164407 CCCAAACTGCTGGGATTACAAGG - Intronic
933384619 2:81594129-81594151 GAGAACCTGCTGGCATGACATGG + Intergenic
934910278 2:98246639-98246661 CCCAGAGTGCTGGGATTACAAGG + Intronic
935896408 2:107742634-107742656 CCCAGAGTGCTGGGATTACACGG - Intergenic
937064712 2:119009215-119009237 GACCACCTGCTGCCATTACAAGG + Intergenic
937386896 2:121442736-121442758 CCCAAACTGCTGGGATTACAGGG + Intronic
937865185 2:126745638-126745660 CCCAAACTGCTGGGATTACAGGG + Intergenic
938300550 2:130208262-130208284 CCCAGAGTGCTGGGATTACAGGG - Intergenic
938456176 2:131466209-131466231 CCCAGAGTGCTGGGATTACAGGG + Intronic
939862189 2:147433846-147433868 CACAGGCTGCAGGGATGACATGG - Intergenic
940255364 2:151722806-151722828 CCCAAACTGCTGGGATTACAGGG + Intronic
940398733 2:153222531-153222553 GACAGCCTGCTGGGCAGAAAGGG - Intergenic
941456611 2:165717045-165717067 CCCATCGTGCTGGGATTACAGGG - Intergenic
941677380 2:168357866-168357888 CACACAGTGCTGGGATTACAGGG + Intergenic
942657020 2:178224673-178224695 GCCAAAGTGCTGGGATTACAGGG - Intronic
942898156 2:181083179-181083201 GAGAGGCTGCTGGGTTTACAGGG - Intergenic
944218094 2:197275577-197275599 GGCAACCTGCTGGGACCACAAGG + Intronic
944634240 2:201659153-201659175 CCCAAACTGCTGGGATTACAGGG + Intronic
944713719 2:202358915-202358937 CCCAAACTGCTGGGATTACAGGG - Intergenic
944765064 2:202855814-202855836 CCCAGAGTGCTGGGATTACAGGG - Intronic
945051540 2:205828578-205828600 CCCAGAGTGCTGGGATTACAGGG - Intergenic
945236870 2:207639248-207639270 CCCAGAGTGCTGGGATTACAGGG + Intergenic
945542093 2:211100631-211100653 AAAAATCTGCTGGGATTACATGG - Intergenic
945823344 2:214691162-214691184 CACAAAGTGCTGGGATTACAGGG - Intergenic
945966372 2:216191668-216191690 CCCAGAGTGCTGGGATTACAGGG + Intronic
946955924 2:224929939-224929961 CACAGAGTGCTGGGATTACAGGG - Intronic
947527974 2:230890984-230891006 CCCAAACTGCTGGGATTACAGGG - Intergenic
948698484 2:239746207-239746229 GACAGCTTTCAGGAATTACAGGG + Intergenic
1168845526 20:941838-941860 CTCAACATGCTGGGATTACAGGG - Intergenic
1170641725 20:18160158-18160180 CACAAAGTGCTGGGATTACAGGG + Intronic
1172955100 20:38750888-38750910 CCCAACATGCTGGGATTACAGGG + Intronic
1173291959 20:41723133-41723155 GATAGCCTGCTTAGCTTACAGGG + Intergenic
1173374263 20:42469460-42469482 CCCAGAGTGCTGGGATTACAGGG + Intronic
1173407755 20:42781339-42781361 GGGTGTCTGCTGGGATTACATGG - Intronic
1174352753 20:49980163-49980185 GCCAAAGTGCTGGGATTACAGGG - Intergenic
1174807221 20:53615204-53615226 CCCAAACTGCTGGGATTACAGGG + Intergenic
1175692088 20:61072869-61072891 GACAGCCTGGTGGGATGAGAAGG - Intergenic
1176293764 21:5059708-5059730 CACAGCCCGCTGGGACTCCAGGG - Intergenic
1177448835 21:21238214-21238236 CCCAGAGTGCTGGGATTACAGGG + Intronic
1177475158 21:21611042-21611064 GACATCCTTTTGGGATTACTTGG + Intergenic
1178150719 21:29790710-29790732 CCCAGAGTGCTGGGATTACAGGG + Intronic
1178587745 21:33884167-33884189 GCCAGAATTCTGGGATTACAGGG + Intronic
1178953291 21:37003045-37003067 TCCAAACTGCTGGGATTACAGGG + Intergenic
1179863495 21:44203940-44203962 CACAGCCCGCTGGGACTCCAGGG + Intergenic
1181183467 22:21083698-21083720 CTCAGTCTCCTGGGATTACAGGG - Intergenic
1181690866 22:24559472-24559494 GACAACTTGCTGGGTTTCCAGGG + Intronic
1182206450 22:28632864-28632886 CCCAGTATGCTGGGATTACAGGG - Intronic
1182252897 22:29015756-29015778 CCCAAACTGCTGGGATTACAGGG - Intronic
1182535391 22:30998458-30998480 GGTAGCCTTCTGGAATTACAGGG - Intergenic
1183451856 22:37900593-37900615 CCCAAACTGCTGGGATTACAAGG + Intergenic
1183876857 22:40789898-40789920 CCCAAACTGCTGGGATTACAGGG + Intronic
1183950898 22:41352499-41352521 CAAAGGCTGGTGGGATTACAGGG - Intronic
1184122422 22:42460794-42460816 CCCAAACTGCTGGGATTACAGGG - Intergenic
1185353666 22:50352468-50352490 CACAAAGTGCTGGGATTACAGGG - Intronic
949262742 3:2121238-2121260 CCCAGAGTGCTGGGATTACACGG - Intronic
951025932 3:17829908-17829930 CCCAGCATGCTGGAATTACAGGG + Intronic
951348322 3:21573798-21573820 TCCAGAGTGCTGGGATTACATGG - Intronic
951883477 3:27501861-27501883 CCCAAACTGCTGGGATTACAGGG + Intergenic
952381942 3:32812168-32812190 CCCAGAGTGCTGGGATTACAGGG - Intergenic
952799734 3:37278460-37278482 CCCAGAGTGCTGGGATTACAGGG + Intronic
952830598 3:37561639-37561661 GAAAGCCTGGTGGGATCACAGGG + Intronic
953995041 3:47513249-47513271 CCCAAACTGCTGGGATTACAGGG + Intronic
955322493 3:57984289-57984311 CAGAGCCTGCTGTGATTACATGG - Intergenic
956479875 3:69662695-69662717 CCCAGAATGCTGGGATTACAGGG - Intergenic
957461608 3:80528710-80528732 GACAGCTTGATGGTATTATAAGG - Intergenic
957963409 3:87290092-87290114 CCCAAACTGCTGGGATTACAGGG - Intergenic
958717496 3:97803183-97803205 GATTACCTGCTGGGATTACAGGG - Intergenic
960099279 3:113722131-113722153 GACAGCTGGCTGAGATTAGAAGG + Intronic
960606883 3:119515276-119515298 GACAGCCTGCAAGGAAAACAGGG - Intronic
961634179 3:128322478-128322500 GACAGCCTGGTGGGGTTTCGAGG + Intronic
961668904 3:128513046-128513068 CCCAAACTGCTGGGATTACAGGG - Intergenic
962025385 3:131541928-131541950 CCCAAACTGCTGGGATTACAGGG + Intronic
962373081 3:134837407-134837429 GTCATCCTGCTGGGTTCACATGG + Intronic
962651832 3:137502446-137502468 CCCAGAGTGCTGGGATTACAGGG - Intergenic
963112818 3:141700957-141700979 CACAGCCTGGTGGGCTTACCTGG + Intergenic
963168851 3:142231334-142231356 CCCAAACTGCTGGGATTACAGGG - Intergenic
963182176 3:142369784-142369806 CACAAAGTGCTGGGATTACAGGG - Intronic
964760756 3:160133313-160133335 GCCACCCTGTTGGGGTTACAGGG - Intergenic
964996304 3:162885981-162886003 CACAGGGTGCTGAGATTACAGGG + Intergenic
965365338 3:167791863-167791885 CCCAGAGTGCTGGGATTACAGGG - Intronic
965912919 3:173803357-173803379 CCCAGAGTGCTGGGATTACAGGG - Intronic
966088348 3:176098897-176098919 CACAGCCTGCGGGGTTTTCATGG - Intergenic
966183465 3:177207539-177207561 CCCAACATGCTGGGATTACAGGG + Intergenic
966740966 3:183233089-183233111 CCCAGAGTGCTGGGATTACAGGG - Intronic
967051724 3:185791105-185791127 GACAGCCTGGTGGGAGAATATGG - Intronic
967803273 3:193688719-193688741 CACAAACTGCTGGAATTACAGGG - Intronic
968265843 3:197362827-197362849 CCCAAACTGCTGGGATTACAGGG + Intergenic
968693038 4:2005949-2005971 GCCTGCCTGCTGGGATTTTAAGG - Intronic
968772593 4:2517168-2517190 CCCAACCAGCTGGGATTACAGGG + Intronic
968956731 4:3723302-3723324 GACAGCAGGGTAGGATTACAGGG - Intergenic
970633414 4:17979984-17980006 TACAGGCTGCTGGCATTCCATGG - Intronic
970783105 4:19762987-19763009 CACAAAATGCTGGGATTACAGGG + Intergenic
971325639 4:25641417-25641439 CACAAAGTGCTGGGATTACAGGG - Intergenic
971750252 4:30638101-30638123 CCCAGACTGCTGGGATTATAGGG - Intergenic
973052074 4:45609447-45609469 CACAGCCTGGTGGGCTTACCCGG - Intergenic
974646248 4:64697115-64697137 GACAGAGTGCTGGGATTACAGGG - Intergenic
974950373 4:68578660-68578682 CACAGCCTGGTGGGCTTACCTGG - Intronic
975331190 4:73115547-73115569 CCCAAACTGCTGGGATTACAAGG + Intronic
975471880 4:74778994-74779016 GACAGGCTTCTGGGTTTTCAGGG + Intronic
976076738 4:81307487-81307509 ACCAGCCTGCTTGGATAACATGG + Intergenic
976379224 4:84380186-84380208 GACAGCATTCTGGGAACACAAGG - Intergenic
976789084 4:88857366-88857388 GCCAAAGTGCTGGGATTACAGGG - Intronic
977628502 4:99215604-99215626 CCCAGAGTGCTGGGATTACAGGG + Intronic
978446453 4:108785351-108785373 CCCAAACTGCTGGGATTACAAGG - Intergenic
979018173 4:115461080-115461102 CCCAACGTGCTGGGATTACAAGG + Intergenic
979452891 4:120893146-120893168 GGCAGGCTGCTGGGAGTCCAGGG + Intronic
979614729 4:122729686-122729708 CCCAAACTGCTGGGATTACAGGG - Intergenic
979821125 4:125173045-125173067 CCCAACGTGCTGGGATTACATGG - Intergenic
979908692 4:126332605-126332627 CCCAGCATGCTGGGATTACAGGG + Intergenic
981660965 4:147166162-147166184 CCCAGAGTGCTGGGATTACATGG + Intergenic
983391772 4:167141033-167141055 GTCAGCCTGATGGGATTGCAGGG - Intronic
984332466 4:178342470-178342492 CACAGAGTGCTGGGATTACAGGG + Intergenic
984398678 4:179233108-179233130 CACAGCCTTCTGGAATTAAATGG - Intergenic
987612718 5:20227745-20227767 CCCAGAGTGCTGGGATTACAGGG + Intronic
987713158 5:21530512-21530534 CCCAACGTGCTGGGATTACAGGG + Intergenic
988243279 5:28641762-28641784 CCCAGAGTGCTGGGATTACAGGG + Intergenic
988279145 5:29122857-29122879 GTCAATGTGCTGGGATTACAGGG + Intergenic
989153893 5:38326057-38326079 GACAGCCTGCTGGGAGCACTGGG + Intronic
989503355 5:42195608-42195630 GACAGCATGATAGGTTTACATGG - Intergenic
989638503 5:43560454-43560476 GACAGTGTGCAGAGATTACATGG - Intergenic
990185028 5:53202784-53202806 CACAGCCTGTTGGGCTTACCTGG - Intergenic
991342454 5:65626477-65626499 CCCAAACTGCTGGGATTACAGGG - Intronic
993262699 5:85680294-85680316 CACAGGGTGCTAGGATTACAGGG + Intergenic
994569861 5:101502539-101502561 CCCAAACTGCTGGGATTACATGG - Intergenic
997559532 5:134834341-134834363 GAGAGCCTCCTAGGATTTCAGGG - Intronic
997768562 5:136530133-136530155 CACAGACTTATGGGATTACAGGG + Intergenic
997961269 5:138323569-138323591 CCCAGAGTGCTGGGATTACAGGG + Intronic
998119884 5:139567476-139567498 CCCAGAGTGCTGGGATTACAGGG + Intronic
998305744 5:141075090-141075112 CCCAAACTGCTGGGATTACAGGG - Intergenic
999077367 5:148809022-148809044 GACAGCCTGGTGGATTAACAGGG - Intergenic
1000295041 5:159906112-159906134 TACAAAGTGCTGGGATTACAGGG + Intergenic
1001520408 5:172387649-172387671 GACAGACAACTGGGATTTCAAGG + Intronic
1002531176 5:179846538-179846560 CCCAGTGTGCTGGGATTACAGGG + Intronic
1002817048 6:690828-690850 GACTGCCTGCTGAAATCACATGG - Intronic
1003285677 6:4732073-4732095 CCCAGAGTGCTGGGATTACAGGG - Intronic
1003297592 6:4846502-4846524 GAAAGCATGCTGGCATCACATGG - Intronic
1003466745 6:6387463-6387485 CACAAAGTGCTGGGATTACAGGG + Intergenic
1003919093 6:10815361-10815383 CCCAGAGTGCTGGGATTACAGGG - Intronic
1003991238 6:11488522-11488544 GTCAGACTGCTAGGATTTCAGGG - Intergenic
1004410199 6:15374398-15374420 GACATCCTGTTGGGTTTATAGGG + Intronic
1004977282 6:20982181-20982203 CTCAGCCTCCTGAGATTACAGGG + Intronic
1005619499 6:27606699-27606721 GCCAAAGTGCTGGGATTACAGGG + Intergenic
1005808068 6:29493670-29493692 CACAAATTGCTGGGATTACAGGG + Intergenic
1006345395 6:33477165-33477187 CCCAAACTGCTGGGATTACAGGG + Intergenic
1006486967 6:34351088-34351110 CCCAGAGTGCTGGGATTACAGGG - Intronic
1009003564 6:57751390-57751412 CCCAACGTGCTGGGATTACAGGG - Intergenic
1010145490 6:72664392-72664414 CCCAACGTGCTGGGATTACAGGG - Intronic
1011417102 6:87133356-87133378 GACAACCTGATCGGATAACAAGG - Intergenic
1011820282 6:91245200-91245222 GACAGACTGCTGGGAGACCATGG + Intergenic
1011954154 6:93004654-93004676 TCCAGAATGCTGGGATTACAGGG - Intergenic
1012595603 6:101034843-101034865 GCCAAACTGCTGGGATTACAGGG - Intergenic
1013531267 6:111020905-111020927 AAAGGGCTGCTGGGATTACAGGG - Intronic
1013532563 6:111033544-111033566 CACAAAGTGCTGGGATTACAGGG + Intergenic
1014237819 6:118979781-118979803 CCCAAACTGCTGGGATTACAAGG - Intronic
1015018381 6:128442211-128442233 GACAGCGTGCAGGGAATTCAGGG - Intronic
1016095522 6:140032086-140032108 CCCAAACTGCTGGGATTACAGGG + Intergenic
1017466082 6:154694930-154694952 CCCAACGTGCTGGGATTACAGGG - Intergenic
1017846786 6:158265420-158265442 CCCAACGTGCTGGGATTACAGGG - Intronic
1018577950 6:165279167-165279189 CCCAAGCTGCTGGGATTACAGGG - Intergenic
1018877339 6:167834718-167834740 CCCAAACTGCTGGGATTACAGGG - Intronic
1019528443 7:1491945-1491967 GACATCCTGCTGGGGTGAGACGG - Intronic
1019765481 7:2846687-2846709 CACAAAGTGCTGGGATTACATGG - Intergenic
1019987064 7:4664933-4664955 GCCAAAGTGCTGGGATTACAGGG - Intergenic
1020239511 7:6382247-6382269 GGCCTCTTGCTGGGATTACAGGG + Intronic
1020913538 7:14163731-14163753 CACAAAGTGCTGGGATTACAGGG - Intronic
1020991390 7:15200750-15200772 CACAAAGTGCTGGGATTACAGGG + Exonic
1021692414 7:23243486-23243508 GGCAGCCTGCCGGGATTCCTGGG + Intronic
1021733377 7:23618812-23618834 CCCAGAGTGCTGGGATTACAGGG + Intronic
1022309459 7:29182879-29182901 GACAGCCTGCTGCCTTTAAATGG + Intronic
1023251176 7:38262916-38262938 CACAAAATGCTGGGATTACAGGG + Intergenic
1023791523 7:43757473-43757495 GACAGGCTGCAGGGATATCAGGG + Intergenic
1024273717 7:47660610-47660632 GCCAAAGTGCTGGGATTACAGGG - Exonic
1024642714 7:51343509-51343531 GACAGACTGCTGGGACCTCAAGG + Intergenic
1025608025 7:63053565-63053587 CCCAAACTGCTGGGATTACAGGG - Intergenic
1026093227 7:67318464-67318486 CCCAGAGTGCTGGGATTACAGGG - Intergenic
1026414997 7:70170405-70170427 GCCTTCCTGGTGGGATTACAGGG + Intronic
1026549542 7:71356511-71356533 GCCAGCCTGCAGAGATTGCATGG + Intronic
1027145474 7:75691227-75691249 CCCAGAGTGCTGGGATTACAGGG - Intronic
1027464655 7:78500827-78500849 CACAAAGTGCTGGGATTACAGGG - Intronic
1028617606 7:92786922-92786944 CCCAGAGTGCTGGGATTACAGGG - Intronic
1029115887 7:98236871-98236893 GACACCCTGCCGGAAGTACACGG + Exonic
1029244467 7:99188939-99188961 CCCAACGTGCTGGGATTACAGGG + Intronic
1029411126 7:100411526-100411548 GCCAAAGTGCTGGGATTACAGGG + Intronic
1029529629 7:101116805-101116827 CACAAAGTGCTGGGATTACAGGG - Intergenic
1029560839 7:101301988-101302010 CCCAGAGTGCTGGGATTACAGGG + Intergenic
1029632571 7:101762329-101762351 CCCAGAGTGCTGGGATTACAGGG - Intergenic
1029637907 7:101797526-101797548 CCCAGAGTGCTGGGATTACAGGG - Intergenic
1029845990 7:103412808-103412830 CCCAGAGTGCTGGGATTACAGGG + Intronic
1029924587 7:104302258-104302280 CCCAAACTGCTGGGATTACAAGG + Intergenic
1030028954 7:105351396-105351418 CCCAGAGTGCTGGGATTACAGGG - Intronic
1030044771 7:105485112-105485134 CACAAAGTGCTGGGATTACAGGG + Intronic
1030456803 7:109785189-109785211 CCCAGGGTGCTGGGATTACAGGG - Intergenic
1030699889 7:112626695-112626717 CCCAGAGTGCTGGGATTACAGGG + Intergenic
1032136812 7:129286718-129286740 CCCAGAGTGCTGGGATTACAGGG + Intronic
1032502391 7:132409821-132409843 GCCAGCCTGTTGGGACTACAGGG - Intronic
1032613955 7:133445750-133445772 TCCAAACTGCTGGGATTACAGGG - Intronic
1032794007 7:135263247-135263269 GACAGCCTGCTGGGCTGAGTAGG - Intergenic
1033236558 7:139642501-139642523 GCAAGCCTGCTGGGAAAACAGGG + Intronic
1034123677 7:148651679-148651701 TCCAGAGTGCTGGGATTACAAGG + Intergenic
1034759601 7:153659031-153659053 TACAGCATGCTGGGATTTGAAGG + Intergenic
1035065123 7:156098789-156098811 CCCAACGTGCTGGGATTACAGGG + Intergenic
1035163652 7:156970026-156970048 CACAAAGTGCTGGGATTACAGGG - Exonic
1036026319 8:4913046-4913068 CCCAAACTGCTGGGATTACAGGG + Intronic
1037694802 8:21214201-21214223 CCCAACGTGCTGGGATTACAGGG + Intergenic
1037810635 8:22084648-22084670 CCCAGAGTGCTGGGATTACAGGG - Intergenic
1037858889 8:22390825-22390847 CTCACACTGCTGGGATTACAGGG + Intronic
1038175404 8:25177660-25177682 TTCAAACTGCTGGGATTACAGGG + Intergenic
1038281181 8:26166566-26166588 CACAAAGTGCTGGGATTACAGGG - Intergenic
1038380265 8:27086415-27086437 CACAAAGTGCTGGGATTACAGGG - Intronic
1038662253 8:29507365-29507387 CCCAAACTGCTGGGATTACAGGG + Intergenic
1040740609 8:50570516-50570538 CCCAGCGTGCTGGGATTACAGGG + Intronic
1043289699 8:78582148-78582170 GAAATATTGCTGGGATTACATGG - Intronic
1043843691 8:85139523-85139545 GCCAAAGTGCTGGGATTACAGGG + Intronic
1044373518 8:91442742-91442764 GAAAGCCTGTTGGGATTATAAGG + Intergenic
1046006854 8:108496547-108496569 CCCAGAGTGCTGGGATTACAGGG + Intergenic
1046020360 8:108657596-108657618 CACAAAGTGCTGGGATTACAGGG - Intronic
1046413186 8:113875969-113875991 CCCAGAGTGCTGGGATTACAGGG - Intergenic
1047030628 8:120875555-120875577 CACAGAGTGCTGGGATTACAGGG + Intergenic
1048805435 8:138237013-138237035 GGCAGCCTGGTGGGAAGACACGG - Intronic
1050602228 9:7264621-7264643 GACAGCCTCTTGGGGTTAGAAGG + Intergenic
1051343103 9:16129256-16129278 GCCAGCCTGCTGGCACTAAAAGG + Intergenic
1052828378 9:33194414-33194436 CCCAGAGTGCTGGGATTACAGGG - Intergenic
1052978565 9:34430267-34430289 CCCAGAGTGCTGGGATTACAGGG - Intronic
1053203861 9:36170531-36170553 GACAGCCTGGCGGTATGACATGG + Exonic
1054261348 9:62868569-62868591 CCCAGAGTGCTGGGATTACAGGG - Intergenic
1055819508 9:80244935-80244957 GCCAAAGTGCTGGGATTACAGGG - Intergenic
1056340883 9:85630737-85630759 GACAAAGTGCTGGGATTAGAGGG + Intronic
1056649780 9:88448605-88448627 CCCAGAGTGCTGGGATTACAGGG + Intronic
1057270862 9:93650669-93650691 GACAGCCTGGGGGGAGAACAAGG - Intronic
1057671850 9:97097616-97097638 CCCAAACTGCTGGGATTACAGGG + Intergenic
1057762533 9:97888433-97888455 CCCAAACTGCTGGGATTACAGGG + Intergenic
1058992604 9:110269145-110269167 CTCAGCCTTCTGAGATTACAGGG - Intergenic
1059215872 9:112561593-112561615 CCCAGAGTGCTGGGATTACAGGG - Intronic
1059908765 9:119019529-119019551 CACAAAGTGCTGGGATTACAGGG - Intergenic
1060609973 9:124954904-124954926 CCCAGTGTGCTGGGATTACAAGG - Intronic
1060623629 9:125090730-125090752 CCCAAACTGCTGGGATTACAGGG + Intronic
1060731271 9:126038544-126038566 CCCAGAGTGCTGGGATTACAGGG - Intergenic
1061017919 9:127993309-127993331 CCCAAACTGCTGGGATTACAAGG + Intergenic
1061050778 9:128193447-128193469 CACAAAGTGCTGGGATTACAGGG - Intronic
1061102334 9:128501657-128501679 CCCAGAGTGCTGGGATTACAGGG + Intergenic
1061206411 9:129166494-129166516 CCCAAACTGCTGGGATTACAGGG - Intergenic
1061792407 9:133065585-133065607 CCCAACGTGCTGGGATTACAGGG - Intronic
1061979879 9:134096010-134096032 CACAGGCAGCTGGGATTACAGGG - Intergenic
1062148367 9:135003928-135003950 CCCAGAGTGCTGGGATTACAGGG + Intergenic
1185466137 X:355442-355464 GACAGCCTGCTGGGATTACATGG - Intronic
1185637242 X:1561694-1561716 CCCAGAGTGCTGGGATTACAGGG + Intergenic
1185789606 X:2918852-2918874 CCCAGAGTGCTGGGATTACAGGG - Intronic
1186482295 X:9905112-9905134 CTCAGAGTGCTGGGATTACAAGG + Intronic
1187540481 X:20188333-20188355 CCCAGAATGCTGGGATTACAGGG + Intronic
1190256313 X:48765310-48765332 CCCAGAGTGCTGGGATTACAGGG - Intronic
1190865053 X:54377443-54377465 CCCAAACTGCTGGGATTACAGGG - Intergenic
1191836794 X:65471708-65471730 CACATAGTGCTGGGATTACAGGG + Intronic
1192946231 X:75967629-75967651 CACAGCCTGGTGGGCTTACCTGG + Intergenic
1193203995 X:78726113-78726135 CACAACGTGCTGGGATTACAAGG + Intergenic
1194716803 X:97295989-97296011 CCCAGAGTGCTGGGATTACAGGG + Intronic
1195441299 X:104901468-104901490 CCCAGAGTGCTGGGATTACAGGG + Intronic
1195797210 X:108663925-108663947 CACAAAGTGCTGGGATTACAGGG - Intronic
1197742005 X:129902449-129902471 CCCAGAGTGCTGGGATTACAGGG + Intergenic
1198508678 X:137327370-137327392 GACAGTCTGCTGGCCTTGCATGG + Intergenic
1198634501 X:138680910-138680932 CCCAAACTGCTGGGATTACAGGG - Intronic
1199575415 X:149308884-149308906 TACAGACTGCTGGAATTCCAAGG + Intergenic
1200159383 X:153997806-153997828 CCCAGACAGCTGGGATTACAGGG - Intergenic
1200267129 X:154652680-154652702 GACAGCCTGAGGGGATGAGATGG - Intronic
1201306188 Y:12552546-12552568 CCCAGAGTGCTGGGATTACAAGG + Intergenic
1202073391 Y:21015548-21015570 CACAGCCTGCTGGGCTTAATGGG - Intergenic
1202078091 Y:21057402-21057424 CACAGCCTGCTGGGCTTAATGGG - Intergenic