ID: 1185466143

View in Genome Browser
Species Human (GRCh38)
Location X:355461-355483
Sequence TGTCGTAGCAACGGAGGGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 32}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185466133_1185466143 24 Left 1185466133 X:355414-355436 CCAAGTTCATCTGGAGTCAACAG 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1185466143 X:355461-355483 TGTCGTAGCAACGGAGGGACCGG 0: 1
1: 0
2: 0
3: 0
4: 32
1185466137_1185466143 -4 Left 1185466137 X:355442-355464 CCATGTAATCCCAGCAGGCTGTC 0: 1
1: 0
2: 2
3: 25
4: 479
Right 1185466143 X:355461-355483 TGTCGTAGCAACGGAGGGACCGG 0: 1
1: 0
2: 0
3: 0
4: 32
1185466136_1185466143 -3 Left 1185466136 X:355441-355463 CCCATGTAATCCCAGCAGGCTGT 0: 1
1: 0
2: 2
3: 26
4: 443
Right 1185466143 X:355461-355483 TGTCGTAGCAACGGAGGGACCGG 0: 1
1: 0
2: 0
3: 0
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185466143 Original CRISPR TGTCGTAGCAACGGAGGGAC CGG Intronic
906889367 1:49691381-49691403 TGTCCTTGAAACAGAGGGACAGG + Intronic
911393638 1:97277658-97277680 TGTAGTAGCAATGGAGGAATTGG - Intronic
914378794 1:147097889-147097911 TGTCCTATCATTGGAGGGACAGG - Intergenic
916194648 1:162211814-162211836 TGTCCTGCCATCGGAGGGACTGG + Intronic
920531994 1:206709220-206709242 TGAAGGAGCAACTGAGGGACTGG - Intronic
921592249 1:217018258-217018280 TGTCCTAGCAATGTAGAGACTGG - Intronic
1089352319 11:117828615-117828637 TGTCGTGGCACCTGAGGCACCGG + Intronic
1093018183 12:14175952-14175974 TGTTATGGCTACGGAGGGACTGG - Intergenic
1097016666 12:55992198-55992220 TGTTGTAGCAACTGAGGGGGTGG + Exonic
1126528268 15:49682835-49682857 TGGAGTTGCAACAGAGGGACAGG - Intergenic
1138196827 16:55058205-55058227 TGTCTTGGCAAAGGAGGGAGTGG - Intergenic
1143854581 17:9839335-9839357 TGGAGTAGAAACTGAGGGACAGG + Intronic
1150670684 17:67194280-67194302 TGTCCTAGCAACTGGTGGACAGG + Intronic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1167470384 19:49672461-49672483 TCTCTGAGCAGCGGAGGGACAGG + Intronic
1167555588 19:50193191-50193213 TGTCTGAGCAGAGGAGGGACAGG + Intronic
936768456 2:115882819-115882841 TGTCATAGCAATGGAGTAACTGG - Intergenic
1169394647 20:5218895-5218917 GGTGGTAGCAAGGGAGGGAATGG - Intergenic
1174112186 20:48204654-48204676 TGTCCCAGCACAGGAGGGACAGG + Intergenic
1179528422 21:42000071-42000093 GGTGGTAGCAACGGAGGTAAAGG + Intronic
1182736967 22:32537657-32537679 TGTCAGAGCACAGGAGGGACTGG + Intronic
1016416863 6:143842897-143842919 TGCCGTAGCAACGGAGGCTGGGG - Intronic
1020927381 7:14348165-14348187 TGTCGAAGGAAAGGAGGGAGTGG - Intronic
1023857664 7:44194648-44194670 TGTCAGAGCAAGGGAGGAACAGG - Intronic
1024286659 7:47763596-47763618 TGTCGTGGCCACGGGAGGACCGG + Intronic
1052049169 9:23825425-23825447 TGGCTCAGCAACGGAAGGACGGG - Intronic
1056226570 9:84501309-84501331 TGTGGTAGCAGCAGAGGGAGTGG - Intergenic
1057824305 9:98360359-98360381 TACCATAGCAACAGAGGGACAGG + Intronic
1060583696 9:124772526-124772548 TTTCGTAGCAGGTGAGGGACGGG - Intergenic
1185466143 X:355461-355483 TGTCGTAGCAACGGAGGGACCGG + Intronic
1196457351 X:115899943-115899965 GGTGGTAGAAACGGAGGGAGTGG - Intergenic
1196607639 X:117674202-117674224 TGTTGTAGCACAGGAGAGACTGG + Intergenic
1201073777 Y:10171676-10171698 TTTCCTAGCAACGGAGCTACTGG - Intergenic