ID: 1185467113

View in Genome Browser
Species Human (GRCh38)
Location X:361729-361751
Sequence TACGTGTGTGGTCCCCCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 26}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185467113_1185467117 -10 Left 1185467113 X:361729-361751 CCCTGCGGGGGACCACACACGTA 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1185467117 X:361742-361764 CACACACGTACTCCACTGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 94
1185467113_1185467126 28 Left 1185467113 X:361729-361751 CCCTGCGGGGGACCACACACGTA 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1185467126 X:361780-361802 GAGGCCACACCATGCTGCCATGG 0: 1
1: 0
2: 5
3: 53
4: 819
1185467113_1185467120 9 Left 1185467113 X:361729-361751 CCCTGCGGGGGACCACACACGTA 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1185467120 X:361761-361783 AGGGCCCACCTTCACCCAGGAGG 0: 1
1: 0
2: 1
3: 29
4: 262
1185467113_1185467119 6 Left 1185467113 X:361729-361751 CCCTGCGGGGGACCACACACGTA 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1185467119 X:361758-361780 TGCAGGGCCCACCTTCACCCAGG 0: 1
1: 0
2: 7
3: 34
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185467113 Original CRISPR TACGTGTGTGGTCCCCCGCA GGG (reversed) Intronic
900953937 1:5875378-5875400 CACGAGTCTGGCCCCCCGCACGG + Intronic
919488012 1:198168357-198168379 TTAGTGTGTGGTCCCTGGCAGGG + Intronic
1100792852 12:98149706-98149728 AACGTGTGTGGTTCCCTGTATGG + Intergenic
1100850912 12:98710014-98710036 TACATGTGTGCTACCACGCATGG + Intronic
1101011891 12:100459245-100459267 TACGTGTGTGCACCCCTGCCAGG - Intergenic
1105993804 13:25650202-25650224 CACTTGTGTGGTCCACAGCATGG - Intronic
1106253510 13:28001808-28001830 TCCGGGTGGGGTCCCCAGCAGGG - Intergenic
1113632154 13:111895592-111895614 TACATGTGTGTACACCCGCATGG + Intergenic
1125430428 15:39588220-39588242 TAAGTGTGAGGTCCGCTGCAAGG + Intronic
1126237346 15:46401430-46401452 TACGTGTGGGGTCCACAGAATGG - Intergenic
1131797851 15:96038096-96038118 CACGTTTGTTTTCCCCCGCAGGG - Intergenic
1153752355 18:8245682-8245704 TATCTGTGTGGTCCCCTTCAAGG - Intronic
1156376208 18:36517403-36517425 TCCCTGTGGGGTCCCCTGCATGG + Intronic
930722954 2:54655573-54655595 TGCGTGTGTGGCCCCCTGCATGG + Intronic
932818554 2:74880542-74880564 TACGTGTGTGCTACCCCGGACGG + Exonic
954193928 3:48984914-48984936 TTCCTGTGTTGTCCCCAGCAAGG + Exonic
956750464 3:72340483-72340505 CACCTGTGTGGTCTCCAGCAGGG + Intergenic
969300407 4:6293974-6293996 CACTTGTGTGGGCCCCCCCAAGG + Intronic
969608546 4:8214352-8214374 TGGGTGTGTCGTCCCCCGCCGGG + Intronic
977226669 4:94400003-94400025 TAAGTGTGTGGGCCCCTGGAAGG + Intergenic
978904832 4:113993712-113993734 TAGCTGTGTGGTCCCTCTCAGGG + Intergenic
1000426802 5:161100751-161100773 TACCTGTGTGTTCACCCTCATGG - Intergenic
1016447494 6:144149016-144149038 TACATGTGTGGTCTCCCTCCTGG - Intergenic
1019340255 7:505513-505535 TTGGGGTGGGGTCCCCCGCAGGG - Intronic
1027670580 7:81091809-81091831 TACAGGTGTGATCCACCGCACGG + Intergenic
1035110171 7:156475332-156475354 TCCGTGTGTGGTGAGCCGCAGGG - Intergenic
1041370064 8:57149867-57149889 TACCTGTGTGTTCCCTCCCACGG - Intergenic
1185467113 X:361729-361751 TACGTGTGTGGTCCCCCGCAGGG - Intronic
1193663128 X:84281268-84281290 TACGGGCGTGGGCCACCGCAGGG + Intergenic