ID: 1185467117

View in Genome Browser
Species Human (GRCh38)
Location X:361742-361764
Sequence CACACACGTACTCCACTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 94}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185467113_1185467117 -10 Left 1185467113 X:361729-361751 CCCTGCGGGGGACCACACACGTA 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1185467117 X:361742-361764 CACACACGTACTCCACTGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 94
1185467106_1185467117 17 Left 1185467106 X:361702-361724 CCCAGCCGGGAGAGGACACACTG 0: 1
1: 0
2: 0
3: 12
4: 166
Right 1185467117 X:361742-361764 CACACACGTACTCCACTGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 94
1185467107_1185467117 16 Left 1185467107 X:361703-361725 CCAGCCGGGAGAGGACACACTGC 0: 1
1: 0
2: 1
3: 7
4: 121
Right 1185467117 X:361742-361764 CACACACGTACTCCACTGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 94
1185467108_1185467117 12 Left 1185467108 X:361707-361729 CCGGGAGAGGACACACTGCAATC 0: 1
1: 0
2: 0
3: 13
4: 143
Right 1185467117 X:361742-361764 CACACACGTACTCCACTGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 94
1185467105_1185467117 23 Left 1185467105 X:361696-361718 CCTGATCCCAGCCGGGAGAGGAC 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1185467117 X:361742-361764 CACACACGTACTCCACTGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 94
1185467103_1185467117 26 Left 1185467103 X:361693-361715 CCACCTGATCCCAGCCGGGAGAG 0: 1
1: 0
2: 0
3: 18
4: 322
Right 1185467117 X:361742-361764 CACACACGTACTCCACTGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185467117 Original CRISPR CACACACGTACTCCACTGCA GGG Intronic
906600315 1:47121551-47121573 CAAACATGTACTACACTACAAGG + Intergenic
907164733 1:52400282-52400304 CACACACATACTGTACAGCACGG + Intronic
908164160 1:61441283-61441305 CACACACACACACCCCTGCACGG - Intronic
912693070 1:111819182-111819204 CACACAAATACTCTACTGCAGGG + Intronic
915668871 1:157470407-157470429 CACACATGTCCTCCTCTGCCAGG - Intergenic
1063786925 10:9395260-9395282 CACACACAGACCCCACTGCCTGG - Intergenic
1069587277 10:69616490-69616512 CACACACTTGTCCCACTGCAGGG - Intergenic
1076410722 10:130247300-130247322 CACACACACACCCCACTACAAGG - Intergenic
1081158137 11:39720305-39720327 CATACATGAACTCAACTGCAAGG + Intergenic
1083108415 11:60381222-60381244 CTCACCCTGACTCCACTGCAGGG + Intronic
1085053857 11:73393007-73393029 CACACCACTACTCCCCTGCAGGG + Intronic
1090480048 11:127059943-127059965 CACACACTTACTCCATTTCCGGG + Intergenic
1091299726 11:134499894-134499916 CACACACGTACACATGTGCACGG + Intergenic
1091626065 12:2121924-2121946 TACACACCTTCACCACTGCATGG - Intronic
1095044615 12:37487758-37487780 CACACACCTAGTCCACAGCATGG + Intergenic
1100860995 12:98806927-98806949 CACATATGTACTCCTGTGCATGG - Intronic
1103271483 12:119677336-119677358 CACACATGCCCTCCACTTCAGGG - Intronic
1107374570 13:39788182-39788204 TTCACACGTACTCCACCACATGG + Intronic
1111255734 13:85665469-85665491 CTCTCAAGTTCTCCACTGCATGG + Intergenic
1112319894 13:98396228-98396250 CACACACCGACTGCACAGCAGGG - Intronic
1130664529 15:85858689-85858711 CACACACACACACCACTGCTGGG - Intergenic
1132253417 15:100351874-100351896 CACACATGTGCTTCTCTGCAGGG - Intergenic
1135498011 16:22969527-22969549 CACACACTTTCTCCCTTGCAGGG + Intergenic
1141762042 16:86034946-86034968 TTCACACGTGTTCCACTGCATGG - Intergenic
1152235693 17:79137145-79137167 CACACACGTGCTCACATGCATGG + Intronic
1152237043 17:79144106-79144128 CACACACGACATCCTCTGCAGGG - Intronic
1152419916 17:80187007-80187029 CACACACATACTCATATGCATGG + Intronic
1152556286 17:81054778-81054800 CACCCAGGCACTCCACTGCGGGG + Intronic
1152852239 17:82644250-82644272 CACACAACTTCCCCACTGCAGGG + Intronic
1155497917 18:26460799-26460821 CACACACATAAGCCACTGAATGG + Intronic
1161039716 19:2103721-2103743 CACCCACGTCCTCCACAGGATGG + Intronic
1162736713 19:12750977-12750999 CACAGTCATACTCCACTGCAAGG - Intergenic
1162854401 19:13457359-13457381 CACACAGTAACTCCACTCCAAGG + Intronic
1164692079 19:30218698-30218720 CACACACCCACTCCTTTGCAAGG - Intergenic
1167209131 19:48122231-48122253 CACACCCGTCCTCCACTCGAGGG + Intronic
926217683 2:10915412-10915434 CACACACTTGCCCCACTGCAGGG - Intergenic
927096322 2:19750218-19750240 CACCCACCTACTCCACTTCTGGG + Intergenic
927102350 2:19797892-19797914 CACACACCTACTTCAGTTCACGG + Intergenic
927375449 2:22407835-22407857 CACACAGGAATTCCACTCCAGGG - Intergenic
931190760 2:59998017-59998039 CACACAAGGACTCCATAGCAGGG + Intergenic
932284213 2:70518861-70518883 CCCCTATGTACTCCACTGCATGG + Intronic
932840019 2:75073420-75073442 CACACACTTACTCCCTTGAAGGG - Intronic
940464683 2:154013490-154013512 CACAAAAGCACTCCACTGCAAGG - Intronic
943534205 2:189126802-189126824 CACAGAAATACTGCACTGCATGG + Intronic
948955667 2:241288734-241288756 CACACACATACTCCTCACCAGGG + Intronic
1171539155 20:25931371-25931393 CATACACCTAGTCCACAGCATGG + Intergenic
1171801876 20:29628885-29628907 CATACACCTAGTCCACAGCATGG - Intergenic
1171842100 20:30226695-30226717 CATACACCTAGTCCACAGCATGG + Intergenic
1173643546 20:44619666-44619688 CACACACGTATACCTCGGCATGG - Exonic
1175451072 20:59068783-59068805 CACACACATTATCCACTGAAAGG + Intergenic
1175493921 20:59399600-59399622 CACACACGTTCTCCTGTGTACGG - Intergenic
1175775508 20:61651035-61651057 CACACAAGCACACCAGTGCACGG - Intronic
1175775522 20:61651211-61651233 CACACAAGCACACCAGTGCACGG - Intronic
1177470853 21:21559664-21559686 TAAACACCTACTCCACTGAAAGG + Intergenic
1179801899 21:43815165-43815187 CACACCCGTGCACCCCTGCAGGG - Intergenic
1180029679 21:45197713-45197735 CCCAGTAGTACTCCACTGCATGG - Intronic
949496670 3:4638865-4638887 CTCACATGAACTCCACTGCACGG - Intronic
950977232 3:17261049-17261071 AACACCCGTACACCACTACATGG + Intronic
951495566 3:23321332-23321354 CACACAGGTCCTGCTCTGCAGGG - Intronic
961564045 3:127750637-127750659 CACACACACACACCACTGAAAGG + Intronic
975260373 4:72290844-72290866 CACACACCTACCTCACTCCAGGG + Exonic
984186568 4:176551096-176551118 CCCACATGTGCTCCGCTGCATGG - Intergenic
984827053 4:183935152-183935174 CACACAGATACTCCCCAGCATGG + Intronic
986845242 5:11744657-11744679 CACACACACACTCCTCTTCAAGG - Intronic
990194413 5:53298141-53298163 AACCCACCTACTCCACTGCAGGG + Intergenic
990829267 5:59938619-59938641 GACACACATCCTCCACTTCAAGG + Intronic
992100112 5:73399005-73399027 CACACATGCACACCACTGCAGGG + Intergenic
1000918992 5:167116470-167116492 CACTCAAGTCTTCCACTGCAGGG - Intergenic
1001955851 5:175847716-175847738 CACACACAGGCTCCACTACATGG + Intronic
1003074523 6:2971522-2971544 CAGACACGTACTCCAGAGCGGGG + Intronic
1004264736 6:14139375-14139397 CACACACATACACCACAGAATGG - Intergenic
1005049931 6:21675365-21675387 CTCCCACCTACTCCCCTGCAGGG - Intergenic
1006143830 6:31946473-31946495 GACACACGTACTCCAGTGCCTGG - Exonic
1008621152 6:53272733-53272755 CCAACAGGTGCTCCACTGCATGG + Intronic
1008893731 6:56527107-56527129 CACAAACGTAATACACTGCATGG - Intronic
1009766437 6:68082409-68082431 CACACACATTCTCCCCTCCAAGG + Intergenic
1011856206 6:91694494-91694516 CACTCACGTACTGTATTGCATGG + Intergenic
1018931494 6:168242996-168243018 CACACACACACTCCAAGGCAGGG - Intergenic
1019659857 7:2218197-2218219 CCAACACACACTCCACTGCATGG + Intronic
1021928335 7:25554387-25554409 CACACACATACCCCACAGAATGG - Intergenic
1025290547 7:57717300-57717322 CACACACCTAGTCCATGGCATGG + Intergenic
1026054149 7:66970346-66970368 CACACACGTAATTCCCTGGATGG - Intergenic
1028583747 7:92433237-92433259 CACACAGGTATTCAACTGCTCGG + Intergenic
1028969145 7:96837683-96837705 TACACATGTACTACACTGTATGG + Intergenic
1029969913 7:104778708-104778730 CACCCACCTGCTGCACTGCAAGG - Intronic
1031335977 7:120532930-120532952 AACACACATACTCCCCTGAAAGG + Intronic
1033456169 7:141505936-141505958 CACTCAGGCTCTCCACTGCAAGG + Intergenic
1034692506 7:153025093-153025115 CAGACACCTCTTCCACTGCAAGG - Intergenic
1037534625 8:19813017-19813039 CAAACACATACTCTACTGGAAGG + Intergenic
1044995821 8:97837232-97837254 CACCCACGCACTCCACAGCCTGG - Intronic
1047013178 8:120693894-120693916 CTCGCATGTACTTCACTGCAAGG + Exonic
1054165894 9:61728075-61728097 CATACACCTAGTCCACAGCATGG - Intergenic
1055121323 9:72664247-72664269 AACACACCTACTGCACTGCCAGG - Intronic
1057280381 9:93706850-93706872 CACACAACTGGTCCACTGCAGGG + Intergenic
1057691946 9:97293380-97293402 CACTCACTAAGTCCACTGCATGG - Intergenic
1185466446 X:357928-357950 CACACACGGACCTCGCTGCACGG + Intronic
1185467117 X:361742-361764 CACACACGTACTCCACTGCAGGG + Intronic
1186502152 X:10060206-10060228 CACCCACGGTCTCCACTGCCTGG - Intronic
1187756679 X:22535175-22535197 CAAAGACTTACTCCAATGCACGG - Intergenic
1195668579 X:107451034-107451056 CACACACTGAAACCACTGCAGGG + Intergenic
1195848304 X:109253658-109253680 CACAAAGGTACTCCAGTCCATGG + Intergenic
1196609417 X:117694847-117694869 CCCACACACACACCACTGCAAGG + Intergenic
1198481573 X:137046198-137046220 CACACACACACTCAATTGCAAGG + Intergenic
1199667997 X:150117287-150117309 CAAACAGCTTCTCCACTGCATGG + Intergenic
1199711729 X:150474293-150474315 CACACTCATACTCCCATGCATGG + Intronic