ID: 1185467119

View in Genome Browser
Species Human (GRCh38)
Location X:361758-361780
Sequence TGCAGGGCCCACCTTCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 7, 3: 34, 4: 273}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185467108_1185467119 28 Left 1185467108 X:361707-361729 CCGGGAGAGGACACACTGCAATC 0: 1
1: 0
2: 0
3: 13
4: 143
Right 1185467119 X:361758-361780 TGCAGGGCCCACCTTCACCCAGG 0: 1
1: 0
2: 7
3: 34
4: 273
1185467115_1185467119 -6 Left 1185467115 X:361741-361763 CCACACACGTACTCCACTGCAGG 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1185467119 X:361758-361780 TGCAGGGCCCACCTTCACCCAGG 0: 1
1: 0
2: 7
3: 34
4: 273
1185467114_1185467119 5 Left 1185467114 X:361730-361752 CCTGCGGGGGACCACACACGTAC 0: 1
1: 0
2: 0
3: 4
4: 23
Right 1185467119 X:361758-361780 TGCAGGGCCCACCTTCACCCAGG 0: 1
1: 0
2: 7
3: 34
4: 273
1185467113_1185467119 6 Left 1185467113 X:361729-361751 CCCTGCGGGGGACCACACACGTA 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1185467119 X:361758-361780 TGCAGGGCCCACCTTCACCCAGG 0: 1
1: 0
2: 7
3: 34
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185467119 Original CRISPR TGCAGGGCCCACCTTCACCC AGG Intronic
900121813 1:1051521-1051543 TGCAGGTCACCCCTGCACCCGGG + Exonic
900179864 1:1306336-1306358 TGAAGCACCCACCTTCTCCCTGG - Intronic
900390486 1:2431831-2431853 TGCTGGGCCTACCCTCATCCTGG + Intronic
900417154 1:2540500-2540522 TCCAGGCCCCACCTTCACCAAGG + Intergenic
900950888 1:5857858-5857880 TGCAGGGCCCAGCTTCCACGTGG + Intergenic
901652658 1:10752070-10752092 TGCAGGGCACACCCTCCCCAAGG + Intronic
901700710 1:11043659-11043681 TGCAGGGCCCAGCCCAACCCAGG - Intronic
902174338 1:14638121-14638143 ACCAGGGCCCACCCTCATCCAGG + Intronic
902231531 1:15030686-15030708 TGCAGGGCCCACCCGCTGCCTGG + Intronic
902725759 1:18334960-18334982 TGCCAGGACCACCTTCTCCCTGG - Exonic
903655748 1:24947954-24947976 GGGAGGCCCCACCTTCTCCCGGG + Intronic
903736256 1:25531524-25531546 CGCTGGCCTCACCTTCACCCTGG - Intergenic
903884215 1:26531546-26531568 GGCAGGGGCCAGCTTCACCAGGG + Intronic
905766665 1:40607389-40607411 TGCCTGGACCACCTCCACCCCGG + Intergenic
907399455 1:54215950-54215972 GGCCGGGCCTTCCTTCACCCAGG - Intronic
907407800 1:54264274-54264296 GGCAGGTCTCACCGTCACCCAGG - Intronic
907481059 1:54745767-54745789 CGCAGGGCCCATCTACATCCAGG + Intergenic
908581988 1:65525808-65525830 AGCAGGTCCCACCTTGATCCGGG - Intronic
912382158 1:109253572-109253594 TGCAGGCCCCACCTTCTGCTGGG + Intronic
917422931 1:174883688-174883710 GGCAGGGCCCACATTGACCAAGG + Intronic
920005759 1:202832668-202832690 TGCTGGACCCACCTTCCCCCAGG - Intergenic
922728886 1:227939950-227939972 ACCAGGGCCCAGCTGCACCCAGG + Intronic
922752321 1:228076106-228076128 TCCAGGGCCCACCCTAATCCAGG + Exonic
922796206 1:228341018-228341040 TGCAGGCCCCACAGCCACCCAGG - Intronic
922912732 1:229231219-229231241 TGCAGGGCTCACCTTAACTTTGG - Intergenic
923548363 1:234941391-234941413 TTCAGAGCCCACCTTGATCCAGG + Intergenic
1063985730 10:11499551-11499573 TGTAGGGTCCACCCTCATCCAGG - Intronic
1064143052 10:12806408-12806430 TGCAGGTCACACCTCCTCCCGGG + Intronic
1066211826 10:33247697-33247719 TGCAAGCCTCACCTGCACCCTGG + Intronic
1067227846 10:44386839-44386861 TCCAGGGCGCCCCTCCACCCGGG - Intergenic
1067714924 10:48683533-48683555 TGGAGGGCCCACCTGCACCCAGG - Intergenic
1068674775 10:59759615-59759637 TGCAGGGGCCAGTTTCTCCCTGG + Intergenic
1072609793 10:97010625-97010647 TGGAGGGCCCACCCTCCCTCTGG - Intronic
1073953483 10:108839082-108839104 TGAGGGGCCCACCTGCACACTGG - Intergenic
1074182647 10:111077531-111077553 TGCGGGGCCCGCCCCCACCCCGG - Exonic
1074558874 10:114517223-114517245 TTCAGGGCCCACCTGAATCCAGG - Intronic
1075176897 10:120172719-120172741 TTCAGAGTCCTCCTTCACCCCGG + Intergenic
1076319340 10:129566542-129566564 TGGAGGGCCCATCATCATCCTGG + Intronic
1076497108 10:130904551-130904573 GGCAGGGCCAGCTTTCACCCTGG - Intergenic
1076701955 10:132277880-132277902 TGCAGGGCCAGCCTGCACTCTGG + Intronic
1076722987 10:132400864-132400886 TCCCGGGCCCACATTCACCCTGG - Intronic
1076753583 10:132556051-132556073 TGGAGGAGCCGCCTTCACCCAGG + Intronic
1076779258 10:132715001-132715023 TGCACGGCCCGGCCTCACCCAGG - Intronic
1076849116 10:133084345-133084367 TGCCAGGCCCACCTCCACCAAGG + Intronic
1076872931 10:133202436-133202458 TGCAGGCCTCTCCTGCACCCAGG - Intronic
1077201292 11:1309003-1309025 TTCAGGGCCCGCCTCCACCTGGG + Intronic
1077334662 11:1997947-1997969 CGCAGGGCCCACCTCCGCCCTGG + Intergenic
1079452079 11:20606059-20606081 TCCAGTGCCCACCTTGACTCTGG + Intronic
1079487318 11:20948892-20948914 TGCAGGGACCTCCTTAACTCTGG - Intronic
1081913806 11:46718426-46718448 TGAGGGGCCCTCCTTCTCCCTGG - Intergenic
1082828460 11:57598100-57598122 TCCTGGGGCCACCTTCTCCCTGG - Intronic
1083818467 11:65151418-65151440 TCCAGTGCCCACCTTGAACCAGG + Intergenic
1085465336 11:76719645-76719667 TGCAGTGCTCACCATCAGCCAGG - Intergenic
1086533181 11:87811117-87811139 TGCAGTGCCCTCCTTACCCCTGG + Intergenic
1087531328 11:99386148-99386170 AGCAGGGCCCACCTCCAACCTGG + Intronic
1088984102 11:114890319-114890341 GGCACTGCCCACCTTCACCCTGG + Intergenic
1089197263 11:116701585-116701607 TGCAGGGTCCTCATGCACCCAGG + Intergenic
1091338453 11:134792103-134792125 TGCAGGGGCAACCCTCAGCCGGG - Intergenic
1202817645 11_KI270721v1_random:53129-53151 CGCAGGGCCCACCTCCGCCCTGG + Intergenic
1093566832 12:20616363-20616385 TGCAGGAAGCACCTTCATCCAGG + Exonic
1093662693 12:21774992-21775014 TGCAGGTCCCGCCCTCCCCCGGG - Intronic
1096789265 12:54034841-54034863 GGCCGGGCCCACCTTAACTCGGG - Exonic
1100956545 12:99915254-99915276 TGAAGGGCACACCTTCACATTGG + Intronic
1101436611 12:104669672-104669694 TGCAGGGCGCAGCTTGACCTTGG - Intronic
1101940674 12:109097470-109097492 TGCACGCCCCACCTCCTCCCAGG + Intergenic
1102418057 12:112781519-112781541 TTCAGGCCCCCCATTCACCCAGG - Intronic
1102452476 12:113052275-113052297 AGCAGTGCCCACCTTAACCTTGG + Intergenic
1103226460 12:119292020-119292042 TTCATGGCCCACCTTCACAGAGG - Intergenic
1104738821 12:131157737-131157759 AGCAGGGCCCCACTTCACCAAGG - Intergenic
1106004369 13:25755266-25755288 TGTAGCTCCCAGCTTCACCCAGG + Intronic
1107411261 13:40160718-40160740 TGCAGAGCCCACCTGCTCCCTGG - Intergenic
1111102963 13:83611474-83611496 TGCAGGGCACAACCTCCCCCTGG + Intergenic
1111717634 13:91899657-91899679 TTTAGGGCCCACCTTCATCCAGG - Intronic
1113935909 13:113995594-113995616 AGCAGGGCCCCCCATCAGCCGGG - Intronic
1113942623 13:114026323-114026345 AACAGGGCCCACCCTCCCCCTGG + Intronic
1114598569 14:23935143-23935165 TCCAGGCCCCACCTCCACACTGG + Intergenic
1115907047 14:38211499-38211521 TGCAGGGCACACCTTCCCCGGGG + Exonic
1117987413 14:61401112-61401134 TGGAGGACCAACATTCACCCAGG + Intronic
1121589138 14:95087110-95087132 TGCAGTGCCCACCTGCCTCCAGG + Exonic
1122540003 14:102492795-102492817 AGCGGGGCCCAGCCTCACCCTGG - Intronic
1122546866 14:102527917-102527939 AGCAGGTCCCACCTTTCCCCAGG - Intergenic
1122601735 14:102925059-102925081 TGCAGGCCCCACAGTCACCCTGG - Intronic
1122829730 14:104389831-104389853 TGCAGGGACCCCCTTCCCCGAGG - Intergenic
1122949552 14:105034254-105034276 TGCTTGGCCCCCATTCACCCAGG - Intergenic
1123738061 15:23204765-23204787 TTTAGGGCCCACCTTCACCCAGG - Intergenic
1123943850 15:25229520-25229542 TGCCTGGACCACCATCACCCCGG - Intergenic
1124289272 15:28433429-28433451 TTTAGGGCCCACCTTCACCCAGG - Intergenic
1124293950 15:28483879-28483901 TTTAGGGCCCACCTTCACCCAGG + Intergenic
1124616898 15:31248602-31248624 TGCAGGGCCCACCTGCTCAGAGG - Intergenic
1125578524 15:40770434-40770456 AGCAGGGACCACATGCACCCTGG + Exonic
1128145620 15:65331038-65331060 CCCAGGCCTCACCTTCACCCAGG + Exonic
1128800169 15:70492201-70492223 GGCAGGCCCCACCTCCTCCCAGG - Intergenic
1129032659 15:72629885-72629907 TGCTGGGCCCACCTGCACCATGG + Intergenic
1129217236 15:74107359-74107381 TGCTGGGCCCACCTGCACCCTGG - Intronic
1129237879 15:74234608-74234630 CACAGGGCCCACTTGCACCCTGG + Intergenic
1129331741 15:74831399-74831421 CCCAGACCCCACCTTCACCCAGG - Exonic
1129407437 15:75328706-75328728 TGCTGGACCCACCTGCACCCTGG + Intergenic
1129734383 15:77951639-77951661 TGCTGGGCCCACCTGCACCCTGG - Intergenic
1129841206 15:78744352-78744374 TGCTGGGCCCACCTGCACCCTGG + Intergenic
1130872570 15:87982909-87982931 TGCAGGGAATACCTTCTCCCTGG - Intronic
1132496279 16:264944-264966 TGTCTGGCCCACCCTCACCCAGG - Exonic
1132622161 16:872924-872946 GGCAGGGCCCACCCTGACCCAGG - Intronic
1132803905 16:1766961-1766983 GCCAGGCCCCACCTTCACCACGG - Exonic
1134078430 16:11308519-11308541 GTGAGGCCCCACCTTCACCCAGG - Intronic
1134346073 16:13393080-13393102 TTCAGGGCACACCTTCCCCCAGG - Intergenic
1136349900 16:29699960-29699982 AGCAGGGAGCACCTTCATCCAGG + Intergenic
1136709313 16:32222208-32222230 TTTAGGGCCCACCTTCATCCAGG + Intergenic
1136758597 16:32707211-32707233 TTTAGGGCCCACCTTCATCCAGG - Intergenic
1136809511 16:33163168-33163190 TTTAGGGCCCACCTTCATCCAGG + Intergenic
1136815987 16:33273248-33273270 TTTAGGGCCCACCTTCATCCAGG + Intronic
1138431514 16:56972105-56972127 GGCAGGGCCCAGCTTCCCCAGGG + Intronic
1140041703 16:71412557-71412579 TTCAGCGCCCACCTTCTCCTAGG + Intergenic
1141205685 16:81931670-81931692 TGCCAGGCCCACCTGCACCCGGG - Intronic
1141409300 16:83821630-83821652 TGCAGGGCCCAGCATGACCTTGG - Intergenic
1141670655 16:85490086-85490108 TCCAGGGCCCACCATAACACAGG - Intergenic
1141676771 16:85521928-85521950 AGCGGGGCCCAGCTTCACGCTGG - Intergenic
1142001090 16:87664908-87664930 GGCAGGGGCCAGGTTCACCCTGG - Intronic
1142010588 16:87711881-87711903 TGCACGGGGAACCTTCACCCAGG + Intronic
1142146391 16:88494594-88494616 TGCAGGGCCCCGACTCACCCTGG - Intronic
1142286931 16:89175284-89175306 TGGAGGGGCCACCCCCACCCGGG - Intronic
1203060751 16_KI270728v1_random:967539-967561 TTTAGGGCCCACCTTCATCCAGG - Intergenic
1142994970 17:3754956-3754978 TCCAGGCCCCGCCCTCACCCAGG + Intronic
1143023755 17:3929475-3929497 GGCAGGGCCTCCCTGCACCCCGG - Intronic
1144889867 17:18488547-18488569 TGCTGGGCCCACATTCCCACAGG + Intronic
1145142347 17:20455770-20455792 TGCTGGGCCCACATTCCCACAGG - Intronic
1145793565 17:27643131-27643153 TGCTGGGCCCACATTCCCACAGG + Intronic
1145808375 17:27750682-27750704 TGCTGGGCCCACATTCCCACAGG + Intergenic
1147156333 17:38546215-38546237 TTCAGTGCCTACCTTAACCCGGG + Intronic
1147491328 17:40870191-40870213 TGCAGGGAGCACCTGCACACTGG - Intergenic
1147606620 17:41777311-41777333 TGCTGAGCCCAGCTTCCCCCTGG - Intronic
1148858078 17:50590141-50590163 TGCATGGCCCATCTTGACCTAGG - Intronic
1150820427 17:68430197-68430219 TGCAGGCCCCACACGCACCCAGG + Intronic
1151398143 17:73838664-73838686 TCCAGGGCCCAGATTCACCTGGG - Intergenic
1151464790 17:74277573-74277595 TCCAGGGCCCAAGTTCCCCCTGG + Intronic
1151926455 17:77201133-77201155 TGCATCGCCCCCCTTCATCCAGG - Intronic
1152008267 17:77695763-77695785 TTTAGGGCCCACCCTAACCCAGG + Intergenic
1152100555 17:78299401-78299423 AGCAGGGCCCACCTACCTCCTGG + Intergenic
1152322941 17:79618491-79618513 AGCACGGCCCTCCTTCCCCCAGG - Intergenic
1152757591 17:82093402-82093424 TGCAGGGCCCAGCATCGCACTGG - Exonic
1153740764 18:8124997-8125019 GGGAGGGCCCACCTACACCAAGG - Intronic
1153957710 18:10112222-10112244 AGAAGGGCCCTCCTTCCCCCAGG - Intergenic
1157288374 18:46392837-46392859 TGAAGGGTCCAACTCCACCCAGG - Intronic
1158406252 18:57162251-57162273 TGCAGGGCCCTCCTTCAGAGAGG + Intergenic
1160718239 19:586029-586051 TGCTGGGCTCACCTTGCCCCAGG - Intergenic
1161623795 19:5313696-5313718 TCCAGGGGCCACCTTGACCTTGG - Intronic
1162412374 19:10514294-10514316 TGCGGGGACCACCTCGACCCGGG - Exonic
1162524759 19:11200908-11200930 TGTAGGGCCCACCGTGAACCAGG - Exonic
1162793277 19:13073922-13073944 ATCAGGGCCCAACTTCTCCCTGG + Exonic
1163674436 19:18648390-18648412 TCCAGGGCCCACCTTGGCCGAGG - Intronic
1164429601 19:28175488-28175510 TGCACTCCCCACCTTCATCCAGG + Intergenic
1165013017 19:32862434-32862456 TGCAGGGCCCACCCTCCCGTGGG + Intronic
1165437901 19:35806704-35806726 CCCAGGGCCCGCCTTCACCCGGG + Exonic
1166269774 19:41706906-41706928 AGCAGGGTCCACCCTCACCCGGG + Intronic
1166358559 19:42242178-42242200 CTCACGGCCCAGCTTCACCCCGG + Exonic
1166416274 19:42596571-42596593 AGCAGGGTCCACCCTCACCAGGG - Intronic
1166433005 19:42742121-42742143 AGCAGGGTCCACCCTCACCAGGG - Intronic
1166436108 19:42767347-42767369 AGCAGGGTCCACCCTCACCAGGG - Intronic
1166455851 19:42938836-42938858 AGCAGGGTCCACCCTCACCGGGG - Intronic
1166465648 19:43028111-43028133 AGCAGGGTCCACCCTCACCAGGG - Intronic
1166485402 19:43207263-43207285 AGCAGGGTCCACCCTCACCAGGG - Intronic
1166492553 19:43271183-43271205 AGCAGGGTCCACCCTCACCAGGG - Intergenic
1167507998 19:49881269-49881291 TGCAGAGCCCAGCTGCCCCCAGG + Exonic
1168254240 19:55157239-55157261 TGCAGCGCCCACCCTGGCCCTGG + Intronic
1168301718 19:55408420-55408442 TCCAGCGCCCACCTCCACCACGG - Intergenic
925995412 2:9288751-9288773 TGCAGGGCTCTCCTTTAGCCTGG - Intronic
927029020 2:19101290-19101312 GGCAGGGCCCACTTTAACACAGG - Intergenic
929590171 2:43140385-43140407 CGCTGGGCCCAGATTCACCCTGG - Intergenic
930252342 2:49048807-49048829 TGCAGTGCTCAGATTCACCCTGG - Intronic
930562176 2:52973579-52973601 ACCAGGGCCCACCTTCAACACGG - Intergenic
932276692 2:70457061-70457083 TACCTGGCCCACCTCCACCCAGG + Intronic
933421021 2:82044418-82044440 TCCAGGGCCTCACTTCACCCTGG - Intergenic
933609691 2:84421426-84421448 TTCAGGGTCCACCCTGACCCAGG - Intergenic
933994631 2:87659168-87659190 TGCAGGGCTCAGCTATACCCTGG + Intergenic
936250732 2:110866466-110866488 TGCTTGGCCCACCTCCTCCCTGG - Intronic
936299225 2:111291745-111291767 TGCAGGGCTCAGCTATACCCTGG - Intergenic
937337808 2:121072503-121072525 GGCAGGGCCCATCCTCTCCCTGG + Intergenic
937499464 2:122462430-122462452 TGCAGTGCCCTCCTTACCCCTGG - Intergenic
937906698 2:127055992-127056014 TGCAGAGACCACCCGCACCCAGG - Intronic
941314302 2:163973298-163973320 TGCAGAGCCCACATTCACACAGG - Intergenic
942079257 2:172385007-172385029 TCCAGGGTCCCCGTTCACCCTGG + Intergenic
947729795 2:232421387-232421409 CGCAGAGCTCACCTTCACCAGGG + Intergenic
947870724 2:233436437-233436459 CGCAGGGCCCACACTCACCATGG - Exonic
948397844 2:237660933-237660955 TGCAGGACCCACTGTCATCCTGG + Intronic
948593264 2:239064418-239064440 TGCAGGTCCCGCCTCCAGCCAGG - Intronic
948942128 2:241201849-241201871 TGCAGTGTTCACCGTCACCCAGG + Intronic
1174485117 20:50856080-50856102 TGCCGGGCCCAACCTCACTCAGG - Intronic
1175798357 20:61786226-61786248 TTCAGGGCCCACCTCCTTCCTGG + Intronic
1175892253 20:62321102-62321124 TGCTGGCCCTACCTTCTCCCTGG - Intronic
1176197545 20:63844390-63844412 GGCAGGGCACCCCCTCACCCAGG - Intergenic
1178364274 21:31975571-31975593 ACGAGGGACCACCTTCACCCTGG + Intronic
1179800505 21:43809621-43809643 TGCAGGGCCTACCCTCGCCGGGG - Intergenic
1179960809 21:44766194-44766216 TGCAGTGTCCACCTAGACCCAGG - Intergenic
1180009428 21:45040050-45040072 TGCAGAGCCCAGCATCGCCCAGG - Intergenic
1181050362 22:20235438-20235460 GGCAGGGCCCTCTCTCACCCAGG + Intergenic
1181176880 22:21043013-21043035 TGCAGGGCCCAGCTCTCCCCTGG - Intergenic
1183063639 22:35349743-35349765 TGCAGGGGCCACCTCCTGCCTGG - Intergenic
1183513595 22:38250233-38250255 TGCACTGCCCGCCTGCACCCCGG + Intronic
1183709167 22:39492344-39492366 TGCAGGGAGCACCTTCACTTAGG + Intergenic
1184996292 22:48209798-48209820 GGCAGGGCTAACCTCCACCCAGG - Intergenic
1185182152 22:49369722-49369744 TGCAGGCCCCTGCCTCACCCAGG - Intergenic
1185223737 22:49641714-49641736 TCCTGGGCTCACCCTCACCCAGG + Intronic
1185246214 22:49774713-49774735 TCCAGGGCCCACCCTGACTCTGG - Intronic
950263891 3:11561031-11561053 GGCAGGGCCCTCCTTCCTCCTGG - Intronic
950421609 3:12902938-12902960 TGCCGGGCCCACCTGCCCGCAGG + Intronic
952857584 3:37785011-37785033 GGCAGGATCCACCTTCACCTTGG - Exonic
953771099 3:45779209-45779231 TCCAGGAACCACCTTCACCTTGG - Intronic
953925533 3:46980575-46980597 TCAAGGACCCACCCTCACCCTGG - Intronic
954325030 3:49858932-49858954 TGCAGGTCCCACACTCTCCCAGG - Exonic
954436608 3:50499629-50499651 GGCAGTGCCCACCTGCACACAGG + Intronic
954447321 3:50553724-50553746 ATCTGGGCCCACCTTCAGCCTGG - Intergenic
955618811 3:60838941-60838963 TGCTGGGTTCCCCTTCACCCAGG - Intronic
961486665 3:127221824-127221846 GGCAGAGCCCACATCCACCCTGG + Intergenic
961650901 3:128416234-128416256 GGCAGGGCCCACCCTGCCCCTGG + Intergenic
961684553 3:128620647-128620669 AGCAGGCCCCACCATCTCCCAGG + Intronic
964409522 3:156383360-156383382 TTAAGGGACCATCTTCACCCAGG - Intronic
966917299 3:184592136-184592158 TGGAGGGCACTCCTCCACCCAGG - Intronic
968521599 4:1036889-1036911 TGCAGGGACCACCTTTCCGCTGG - Intergenic
968749373 4:2379312-2379334 TGCACTGCCCACCTGCTCCCGGG - Intronic
968813051 4:2808788-2808810 CTCAGTGCCCACCTTCCCCCAGG + Intronic
968813068 4:2808837-2808859 CTCAGTGCCCACCTTCCCCCAGG + Intronic
968813085 4:2808886-2808908 CTCAGTGCCCACCTTCCCCCAGG + Intronic
968813102 4:2808935-2808957 CTCAGTGCCCACCTTCCCCCAGG + Intronic
968813187 4:2809180-2809202 CTCAGTGCCCACCTTCCCCCAGG + Intronic
968813219 4:2809278-2809300 CTCAGTGCCCACCTTCTCCCAGG + Intronic
968960337 4:3740061-3740083 TGCAGAGCCCACCTGTGCCCAGG - Intergenic
969469272 4:7377643-7377665 GGCAGGGCTCTCCTTCACCCAGG + Intronic
969968599 4:11022729-11022751 TGCAGGGCACACCTTGGCCAGGG - Intergenic
970117973 4:12720550-12720572 AACAGAGCCCACCTTTACCCAGG - Intergenic
972338593 4:38130686-38130708 TGCAGTGCCCACCTCCCCCAGGG - Intronic
973635804 4:52861456-52861478 TGCAGGGCCCACCTCTTCCTTGG + Intergenic
975066295 4:70068599-70068621 TGCAGGTCCCAGTTTAACCCTGG - Intergenic
976303013 4:83533531-83533553 TTTAGGGCCCACCCTCATCCAGG - Intergenic
980301125 4:130996613-130996635 TCCAGGGACCACCTTCCACCTGG - Intergenic
985421630 4:189790360-189790382 TGCAGAAGGCACCTTCACCCGGG - Intergenic
985752297 5:1687551-1687573 TGCAGGGCAAGCCTGCACCCGGG + Intergenic
987076203 5:14384058-14384080 TGCAGGCACCACCTGCATCCAGG + Intronic
987243941 5:16029199-16029221 TGCATGGGCCACTTTCACCACGG + Intergenic
987374076 5:17217997-17218019 TTCTGGGCCCCCCATCACCCGGG - Intronic
991341480 5:65615500-65615522 TGCAGGGCCCCCCTTCCTCCTGG + Intronic
991489127 5:67165974-67165996 CAGAGGGCCCACCTTCTCCCTGG - Exonic
996009053 5:118460190-118460212 ACCAGGGCCCACCTTCACGTGGG - Intergenic
997761579 5:136453874-136453896 TTGATGGACCACCTTCACCCTGG + Intergenic
998134373 5:139667011-139667033 AGCAGGGCCCACCTGGCCCCTGG - Intronic
998453673 5:142253881-142253903 TGCAGGGCCTTCCTTCTCCGAGG - Intergenic
1001317610 5:170655526-170655548 TTCTAGGCCCACCTTCACCAAGG + Intronic
1001886961 5:175301341-175301363 TGCAGGGCCCACATTCCCTGCGG + Intergenic
1001953379 5:175831479-175831501 AACAGGGCCCATCTTCTCCCTGG + Intronic
1002098181 5:176844332-176844354 ATCTGGGCCCACCTCCACCCTGG - Intronic
1002576325 5:180176210-180176232 TCCAGGGCCCACCTGCTCTCTGG - Intronic
1002717459 5:181236666-181236688 ATCAGGGCCTACCTTCAACCTGG - Intergenic
1003654945 6:7998481-7998503 TGCCTGGCCCTCCTCCACCCAGG + Intronic
1006445303 6:34076643-34076665 AGCAGGGACCAGCCTCACCCAGG + Intronic
1007074620 6:39058539-39058561 TGCTGAGCCCAGTTTCACCCAGG + Intronic
1007250197 6:40490068-40490090 TGCTGGGCCCTTCTTCCCCCTGG - Intronic
1011556011 6:88572257-88572279 GGCACAGCCCACATTCACCCAGG - Intergenic
1012033530 6:94102592-94102614 TGAAGGGCACGCCTTCACTCTGG - Intergenic
1016712198 6:147186493-147186515 TTCAGGGCCAACTTTCACCAAGG + Intergenic
1019095089 6:169573103-169573125 TGCAGAGCCCAGGTGCACCCCGG - Intronic
1019339808 7:503609-503631 TGCAGAGCTGACCTTCTCCCTGG - Intronic
1019365566 7:630821-630843 TCCAGGGAGCACCATCACCCAGG + Intronic
1019394759 7:811798-811820 TTCAGGGCCCACCCTAAGCCAGG + Intergenic
1019521669 7:1463487-1463509 AGCTGGGCCGACCTTCTCCCGGG - Intergenic
1019660184 7:2219767-2219789 CGCAGGGCCCACCCTCCTCCTGG + Intronic
1019729883 7:2623875-2623897 TGCAGGCCCCCCCAGCACCCCGG - Intergenic
1019927480 7:4202871-4202893 TGCAGGGCTCAGGTTCACCTTGG + Intronic
1021241052 7:18201536-18201558 TGCAGGGCCCACCCTCAGGGAGG + Intronic
1022447151 7:30479863-30479885 TACTCGGCCCACCTGCACCCAGG + Intergenic
1023819886 7:43974829-43974851 GGAAGGGCCCACCTGGACCCTGG - Intergenic
1024115534 7:46189576-46189598 TGCTGGGCTGACCTTCACCGAGG + Intergenic
1024240214 7:47428997-47429019 TGGACAGGCCACCTTCACCCAGG + Intronic
1026227431 7:68454893-68454915 CGCAGACCCCACCTTCAACCAGG + Intergenic
1027230914 7:76271884-76271906 TGTGGGGGCCACCTGCACCCAGG - Intronic
1027427253 7:78073847-78073869 AGCAGTGCCCTCCTTCACCCTGG - Intronic
1029748161 7:102528282-102528304 GGAAGGGCCCACCTGGACCCTGG - Intergenic
1029766108 7:102627369-102627391 GGAAGGGCCCACCTGGACCCTGG - Intronic
1035770079 8:2139995-2140017 TGCAGGCACCACCACCACCCAGG + Intronic
1035818780 8:2569183-2569205 TGCAGGGACCACCTGCAGCAGGG + Intergenic
1036220888 8:6921000-6921022 TGCAGGGACTACCTTTATCCCGG - Intergenic
1036413022 8:8520053-8520075 TTCAGGTCCTACCTTCACCCTGG + Intergenic
1036709444 8:11068801-11068823 GGCAGGGCCCACCTTGGCCAGGG - Intronic
1039276558 8:35938867-35938889 TCCAGGTCCCCACTTCACCCAGG - Intergenic
1044553463 8:93537047-93537069 TGTGGGGCCCACCTGCAGCCTGG - Intergenic
1044583484 8:93846008-93846030 TGATGCGCCCACCTTCAGCCTGG - Intergenic
1045377926 8:101593726-101593748 TGTAGGGCCCACCTTAATCCAGG - Intronic
1045548238 8:103147586-103147608 TGGAGGTCCAACCTTCACCCTGG + Intronic
1047506741 8:125486244-125486266 AACACGGCCCACCTGCACCCGGG + Intergenic
1048338131 8:133518205-133518227 TGCAGGACCCACCCTCAAGCTGG - Intronic
1049219893 8:141424383-141424405 TACAGGGCCCAGCTTCCTCCTGG + Intronic
1049463843 8:142742154-142742176 CCCAGAGCCCAGCTTCACCCTGG - Intronic
1049530783 8:143153807-143153829 TGCCCTGACCACCTTCACCCGGG + Intergenic
1049684972 8:143935683-143935705 TTCAGGGCCCAGCCCCACCCTGG - Intronic
1049744641 8:144258083-144258105 TACAGGGCCCAGCTTGAGCCTGG - Intronic
1049796812 8:144500769-144500791 TGCGGGGCCCACCTCCACCTGGG + Intronic
1050607207 9:7314519-7314541 GGGTGGGCCCATCTTCACCCTGG + Intergenic
1051837991 9:21362450-21362472 TCCCAGGCCCACCTCCACCCAGG - Intergenic
1051845735 9:21449343-21449365 TCCCAGGCCCACCTCCACCCAGG + Intergenic
1051866832 9:21693217-21693239 GGCAGGGTCCACCTTCCCCGGGG - Intergenic
1053344696 9:37369849-37369871 TGCAGGACCCACCATCATCCTGG + Intergenic
1059404570 9:114092033-114092055 TCCAGGGCCCTTCCTCACCCAGG + Intronic
1061368939 9:130187166-130187188 GGCAGGGCCCCCCGTCTCCCAGG - Intronic
1061499147 9:130992270-130992292 TGCAGGGCCCCCATTCCCCTCGG - Intergenic
1061650419 9:132043860-132043882 TGCAGGTCCCACCTTCCTTCAGG + Intronic
1062047169 9:134429764-134429786 TGGAGGGCCCACCCTCGTCCGGG + Intronic
1062167261 9:135114081-135114103 TTTAGGGCCCACCTTCATCCAGG + Intronic
1062309933 9:135930140-135930162 GGCAGGCCCCACCTGCTCCCCGG + Intergenic
1062519461 9:136951719-136951741 TGCTCGGGCCACCTCCACCCCGG + Intronic
1062566478 9:137166017-137166039 TGCAGGGCCCCCGCTCAGCCTGG - Intronic
1062729956 9:138103241-138103263 TGCAGGCCCCACCTGCCCCCAGG - Intronic
1185467119 X:361758-361780 TGCAGGGCCCACCTTCACCCAGG + Intronic
1185778553 X:2825823-2825845 TGGAGGGGCCAGCTTCATCCTGG + Intergenic
1186298677 X:8176018-8176040 TGCTGGTGCCACCTTTACCCTGG + Intergenic
1188987676 X:36781924-36781946 TGCAGGGTCCACCCTTAGCCTGG + Intergenic
1201439376 Y:13991904-13991926 TGCTGGTGCCACCTTGACCCTGG + Intergenic
1201445197 Y:14050804-14050826 TGCTGGTGCCACCTTGACCCTGG - Intergenic
1201906671 Y:19092655-19092677 TTCAGGGCCCACCCTAATCCAGG + Intergenic