ID: 1185467126

View in Genome Browser
Species Human (GRCh38)
Location X:361780-361802
Sequence GAGGCCACACCATGCTGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 878
Summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 819}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185467114_1185467126 27 Left 1185467114 X:361730-361752 CCTGCGGGGGACCACACACGTAC 0: 1
1: 0
2: 0
3: 4
4: 23
Right 1185467126 X:361780-361802 GAGGCCACACCATGCTGCCATGG 0: 1
1: 0
2: 5
3: 53
4: 819
1185467118_1185467126 3 Left 1185467118 X:361754-361776 CCACTGCAGGGCCCACCTTCACC 0: 1
1: 0
2: 5
3: 43
4: 369
Right 1185467126 X:361780-361802 GAGGCCACACCATGCTGCCATGG 0: 1
1: 0
2: 5
3: 53
4: 819
1185467115_1185467126 16 Left 1185467115 X:361741-361763 CCACACACGTACTCCACTGCAGG 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1185467126 X:361780-361802 GAGGCCACACCATGCTGCCATGG 0: 1
1: 0
2: 5
3: 53
4: 819
1185467122_1185467126 -9 Left 1185467122 X:361766-361788 CCACCTTCACCCAGGAGGCCACA 0: 1
1: 0
2: 9
3: 45
4: 343
Right 1185467126 X:361780-361802 GAGGCCACACCATGCTGCCATGG 0: 1
1: 0
2: 5
3: 53
4: 819
1185467121_1185467126 -8 Left 1185467121 X:361765-361787 CCCACCTTCACCCAGGAGGCCAC 0: 1
1: 0
2: 0
3: 32
4: 279
Right 1185467126 X:361780-361802 GAGGCCACACCATGCTGCCATGG 0: 1
1: 0
2: 5
3: 53
4: 819
1185467113_1185467126 28 Left 1185467113 X:361729-361751 CCCTGCGGGGGACCACACACGTA 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1185467126 X:361780-361802 GAGGCCACACCATGCTGCCATGG 0: 1
1: 0
2: 5
3: 53
4: 819

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185467126 Original CRISPR GAGGCCACACCATGCTGCCA TGG Intronic
900167878 1:1251219-1251241 GGGGACACACCGTGCTCCCAGGG + Intergenic
900414215 1:2527728-2527750 CATGGCACACCATGCTGCCAGGG - Intergenic
900580114 1:3404621-3404643 GAGCCCCCACCACGCTGCCGAGG - Intronic
900646612 1:3711701-3711723 GTGTCCTCACCATCCTGCCATGG - Intronic
901028052 1:6289563-6289585 GGGGCCTCACCATGTTGCCCAGG + Intronic
901080573 1:6581468-6581490 GAGGCCTCGCCATGTTGCCCAGG - Intronic
901136297 1:6998696-6998718 GACGCCACAGCAAGATGCCAGGG - Intronic
902851323 1:19159794-19159816 GAGGTTTCACCATGTTGCCAAGG + Intronic
903051356 1:20603577-20603599 GTGGCCACACTGTGCTGCAAGGG + Intronic
903244930 1:22008340-22008362 GAGGTCTCACCATGTTGCCCAGG + Intronic
903275320 1:22217941-22217963 GAGCCCACACAGTGCGGCCACGG + Intergenic
903305602 1:22410708-22410730 GAGGCTTCACCATGTTGCCCAGG - Intergenic
903369425 1:22825702-22825724 GAGGCCACACCTGGCCCCCAGGG - Intronic
903760909 1:25698148-25698170 GAGGCCACCCCATGGCACCAGGG - Intronic
903917834 1:26777421-26777443 GAGGCTTCACCATGTTGCCCAGG + Intronic
904081380 1:27874447-27874469 GATGTCTCACCATGTTGCCAGGG - Intronic
904238352 1:29128201-29128223 GAGGACACAGCCTGCTGCTAAGG + Intergenic
904240225 1:29139498-29139520 GGGGCCTCACCATGTTGCCCAGG + Intergenic
904261364 1:29289588-29289610 CAGGCCCCACCCTGCTGCCTGGG + Intronic
904318460 1:29681257-29681279 GACCCCACTCCAGGCTGCCAAGG - Intergenic
904439026 1:30517725-30517747 GACCCCACTCCAGGCTGCCAAGG + Intergenic
904504993 1:30945039-30945061 GTGGCCTCACCATGTTGCCCAGG - Intronic
904666324 1:32124482-32124504 GAGGCCTCACTATGTTGCCCAGG - Intronic
904770631 1:32879239-32879261 GGGGTCTCACCATGCTGCCCAGG + Intergenic
905039640 1:34945262-34945284 GAGGTCTCACTATGCTGCCCAGG + Intergenic
905054733 1:35083341-35083363 GGGGTCTCACTATGCTGCCAGGG + Intronic
905082357 1:35335426-35335448 GAGGTTTCACCATGCTGGCAAGG + Intronic
905722803 1:40220933-40220955 GAGGTCTCACTATGCTGCCCAGG - Intronic
905739305 1:40355799-40355821 GAGGTCTCACTATGTTGCCAAGG + Intronic
905808170 1:40891934-40891956 GAGGCCTCACTATGTTGCCCAGG - Intergenic
905845581 1:41228589-41228611 GGGGTCTCACCATGTTGCCAGGG - Intronic
906046311 1:42833746-42833768 GAGCTCTCACCATGCTGCCCAGG + Intronic
906229819 1:44152554-44152576 GAGGTCTCACTATGTTGCCAAGG + Intergenic
906392892 1:45434183-45434205 GAGGTTTCACCATGCTGCCCAGG + Intronic
906866797 1:49430036-49430058 GAGGTTTCACCATGCTGCCCAGG + Intronic
906974639 1:50556642-50556664 GGGGTCTCACCATGTTGCCAAGG - Intronic
907338001 1:53713131-53713153 GAGGTCTCACCATGTTGCCTAGG - Intronic
907338007 1:53713170-53713192 GAGGTCTCACCATGTTGCCCAGG - Intronic
907338013 1:53713209-53713231 GAGGTCTCACCATGTTGCCCAGG - Intronic
907338019 1:53713248-53713270 GAGGTCTCACCATGTTGCCCAGG - Intronic
907338024 1:53713287-53713309 GAGGTCTCACCATGTTGCCCAGG - Intronic
907338030 1:53713326-53713348 GAGGTCTCACCATGTTGCCCAGG - Intronic
907338036 1:53713365-53713387 GAGGTCTCACCATGTTGCCCAGG - Intronic
907338042 1:53713404-53713426 GAGGTCTCACCATGTTGCCCAGG - Intronic
907397108 1:54198824-54198846 GAGGTCTCACCATGTTGCCCAGG + Intronic
907573089 1:55501927-55501949 GAGGACTCACCATGTTGCCCAGG + Intergenic
907954735 1:59217324-59217346 GAGGCCAGGCCACTCTGCCATGG + Intergenic
908591303 1:65638156-65638178 GAGGCCTCACTATGTTGCCCCGG - Exonic
910483496 1:87684220-87684242 CAGGACACCCCATGCAGCCAGGG + Intergenic
910671781 1:89781081-89781103 GAGGTCTCACTATGCTGCCCAGG + Intronic
911080166 1:93920926-93920948 GAGGCCTCACTATGTTGCCCAGG - Intergenic
911588172 1:99715046-99715068 GAGGCCTCACTATGTTGCCTAGG + Intronic
911896673 1:103444597-103444619 GAGGTTTCACCATGTTGCCAAGG - Intergenic
913274803 1:117126612-117126634 GAGGTCTCACCATGTTGCCCAGG + Intergenic
913318497 1:117573023-117573045 GAGGTCTCACCATGTTGCCCAGG - Intergenic
913679586 1:121176361-121176383 GAGGTCTCAGCATGCTGCCCAGG + Intronic
913717602 1:121553414-121553436 GAGGTCTCACCATGTTGCCCAGG + Intergenic
914031419 1:143964008-143964030 GAGGTCTCAGCATGCTGCCCAGG + Intronic
914158028 1:145103956-145103978 GAGGTCTCAGCATGCTGCCCAGG - Intronic
914234536 1:145796576-145796598 GAGGCTTCACCATGTTGCCCAGG + Intronic
914424320 1:147560718-147560740 GAGGTCTCACTATGTTGCCAGGG - Intronic
914558713 1:148794865-148794887 GAGGTCTCACCATGTTGCCCAGG + Intergenic
914614120 1:149335365-149335387 GAGGTCTCACCATGTTGCCCAGG - Intergenic
914707676 1:150184170-150184192 GAGGCCTCACTATGTTGCCTGGG - Intergenic
914862528 1:151398613-151398635 GAGGTCTCACCATGTTGCCAAGG + Intergenic
915359259 1:155276185-155276207 GAGGTCACACTATGTTGCCCAGG - Intronic
916011920 1:160714029-160714051 GAGGTCTCACCATGTTGCCCAGG + Intergenic
916050592 1:161033872-161033894 GAGGTCACACTATGTTGCCCAGG + Intronic
917146996 1:171902959-171902981 GAGGTCCCACTATGCTGCCCAGG - Intronic
917425089 1:174904841-174904863 GGGGTCTCACCATGTTGCCAAGG + Intronic
917854862 1:179091826-179091848 GAGGCAAGACCCTGCTGCCAGGG - Intronic
918221641 1:182441014-182441036 GAGGTCTCACCATGTTGCCCAGG + Intergenic
918440287 1:184559807-184559829 GAGGCTTCACCATGTTGCCCAGG + Intronic
918499877 1:185182474-185182496 GAGGTCTCACTATGCTGCCCAGG - Intronic
919289928 1:195616006-195616028 GGGGCCTCACCATGTTGCCCAGG - Intergenic
919614880 1:199794124-199794146 GAGGTCTCACCATACTGCCCAGG + Intergenic
919736914 1:200958344-200958366 GAGGCCTCACTATGTTGCCCAGG - Intergenic
919741777 1:200985294-200985316 GAGGCCTCACCACGTTGCCCAGG - Intronic
920357170 1:205382452-205382474 GAGGGCTCACCATGTTGCCCAGG + Intronic
920428123 1:205895195-205895217 GAGGTGACACTATACTGCCATGG - Intergenic
920466891 1:206194905-206194927 GAGGTCTCAGCATGCTGCCCAGG + Intronic
921849230 1:219917180-219917202 GAGGCCTCACTATGTTGCCCAGG + Intronic
922551500 1:226497706-226497728 AATGCCACACCATGCCTCCATGG - Intergenic
922822992 1:228497195-228497217 GAGGCCACACGAGGATGCCAAGG - Intergenic
923035635 1:230283306-230283328 GAGGTCTCACCATGTTGCCCAGG + Intergenic
923396606 1:233571878-233571900 GAGGTCTCACCATGTTGCCCAGG - Intergenic
923785299 1:237061501-237061523 GAGGTCTTACCATGTTGCCAAGG + Intronic
923975189 1:239255154-239255176 CAGACCACACCACGTTGCCATGG + Intergenic
924361805 1:243249232-243249254 GAGGTCTCACTATGTTGCCAAGG - Intronic
924390958 1:243556481-243556503 CAGGCCACACAATGCACCCAAGG + Intronic
924730761 1:246709514-246709536 GAGGCCTCACTATGTTGCCCAGG - Intergenic
924758675 1:246964677-246964699 GAGGTCTCACCATGCTGGCCAGG - Intronic
924818547 1:247465001-247465023 GAGGCCTCACCATGTTGCGCAGG - Intergenic
1063430129 10:5980806-5980828 GAGGTCTCACTATGTTGCCAAGG + Intergenic
1063717204 10:8539816-8539838 GAGGCCATACTTTGCTGCAAGGG + Intergenic
1063750594 10:8941689-8941711 CAGGTCACACCATGTTGCCCAGG + Intergenic
1064040996 10:11963527-11963549 GAGGTCTCACTATGTTGCCAAGG + Intronic
1064241745 10:13636228-13636250 GAGGTCTCACCATGTTGCCCAGG - Intronic
1064472952 10:15655892-15655914 GAGGTCTCACCATATTGCCAGGG - Intronic
1064538862 10:16386226-16386248 GAGGTCTCACTATGCTGCCTAGG - Intergenic
1064706069 10:18073902-18073924 AAGGCCTCACTATGCTGCCCAGG + Intergenic
1065222916 10:23514326-23514348 GAGGCCACACAATGCAGCCACGG - Intergenic
1065279221 10:24117446-24117468 GGGGCATCACCATGTTGCCAAGG - Intronic
1065703345 10:28446518-28446540 GAGGTCTCACTATGTTGCCAAGG + Intergenic
1065724111 10:28653747-28653769 GAGATCTCACCATGCTGCCCAGG + Intergenic
1065820489 10:29520714-29520736 GAGGTCTCACCATGTTGCCCAGG - Intronic
1065831002 10:29613527-29613549 GAGGTCTCACTATGTTGCCAGGG + Intronic
1065941350 10:30567046-30567068 GAGGTCTCACCATGTTGCCCAGG + Intergenic
1066006211 10:31148222-31148244 GAGGTCTCACCATGATGCCCAGG - Intergenic
1066372863 10:34831953-34831975 GAGGCCACGGGATGCTGCCTTGG + Intergenic
1067134686 10:43597496-43597518 GAGGTCTCACCATGTTGCCCGGG + Intergenic
1069258209 10:66361158-66361180 GAGGTCTCACTATGCTGCCCAGG + Intronic
1069696784 10:70392326-70392348 GAGGTCTCACTATACTGCCAAGG - Intergenic
1069761071 10:70811904-70811926 GAGGCCACACAATGATTCCTGGG + Intergenic
1069761079 10:70811961-70811983 GAGGCCACACAATGATTCCTGGG + Intergenic
1070124843 10:73612962-73612984 GGGGCCTCACCATGTTGCCAAGG - Intronic
1070340624 10:75495052-75495074 AAGGCCACACCTAGCTGCAAAGG + Intronic
1070487895 10:76948195-76948217 GAGGTCTCACCATGTTGCCCAGG + Intronic
1071559706 10:86635375-86635397 GAGGTCACACTATGCTGCCCAGG + Intergenic
1071845505 10:89517501-89517523 GGGGCCACACTATGTTGCCCAGG + Intronic
1072337394 10:94410430-94410452 GAGGTCTCACCATGTTGCCCAGG + Intronic
1073052340 10:100675850-100675872 GAGGGTTCACCATGCTGCCCAGG + Intergenic
1073131548 10:101192193-101192215 GAGGTCTCACCATGTTGCCCAGG + Intergenic
1073180352 10:101579539-101579561 CAGGCCCCACCTTGCAGCCATGG + Exonic
1073309314 10:102528376-102528398 GAGGCCTCACTATGTTGCCCAGG - Intronic
1073747822 10:106490208-106490230 GAGGTCACACTATGTTGCCTAGG + Intergenic
1074331723 10:112518516-112518538 GAGGTCTCACCATGCTGCCCAGG - Intronic
1074397636 10:113111598-113111620 GAGGTTTCACCATGCTGCCCAGG - Intronic
1074863560 10:117531893-117531915 GAGGCCTCCCAGTGCTGCCAGGG + Intergenic
1074902058 10:117825734-117825756 GAGGCGACATCGTGCAGCCACGG + Intergenic
1075675404 10:124292643-124292665 GGGGCCTCACCATGTTGCCCAGG - Intergenic
1076521897 10:131086504-131086526 GGGGCCTCTCCATGCAGCCAGGG + Intergenic
1076660031 10:132049673-132049695 GAGGTCTCACTATGCTGCCCAGG + Intergenic
1076751087 10:132543607-132543629 GAGGTCTCACTATGCTGCCTAGG + Intronic
1077517702 11:3011861-3011883 GAGGACCCACCATTCTGCCTCGG + Intronic
1077541231 11:3147409-3147431 GAGGCCAGCCCATGGTGACAAGG + Intronic
1077595433 11:3527665-3527687 GAGGCCTCATCATGTTGCCCAGG + Intergenic
1078614883 11:12855750-12855772 GAGGTCTCACTATGCTGCCCAGG - Intronic
1078746763 11:14123122-14123144 GAGGCCTCACTATGTTGCCCAGG + Intronic
1079004950 11:16784934-16784956 GAAGCCCCAACATGCTGCCTTGG - Intronic
1079062132 11:17258377-17258399 GAGGTCTCACTATGCTGCCAAGG + Intronic
1079734422 11:23977938-23977960 GAGGTCTCACCATGTTGCCCAGG + Intergenic
1080535106 11:33213852-33213874 GAGGTCTCACCATGTTGCCCAGG + Intergenic
1080553434 11:33394179-33394201 GGGGCCTCACCATGTTGCCGAGG - Intergenic
1080795477 11:35559142-35559164 AGGGCCACACCATGCCGCTAAGG - Intergenic
1080800137 11:35602809-35602831 GCTGCCGCTCCATGCTGCCATGG + Intergenic
1081933978 11:46892122-46892144 GAGGCCACACTATGTTGCCCAGG + Intronic
1081949367 11:47029904-47029926 GAGGCCTCACTATGTTGCCCAGG - Intronic
1081971055 11:47199019-47199041 GAGGCCTCACTATGTTGCCTAGG - Intergenic
1082027858 11:47585969-47585991 GAGGGCTCACCATGTTGCCCAGG + Intergenic
1082735851 11:56854865-56854887 GAGGCCTTACCATGTTGCCCAGG - Intergenic
1083302851 11:61747887-61747909 GAGGCCAGACTCTGCGGCCAAGG - Intergenic
1083917495 11:65758180-65758202 GAGGCCTCACCATGTTACCCAGG - Intergenic
1083948024 11:65936353-65936375 GAGGTCTCACTATGCTGCCTAGG - Intergenic
1083952650 11:65965455-65965477 GCGACCACCCCATGCTGCCCAGG - Intronic
1083973466 11:66097983-66098005 GAGGTTTCACCATGTTGCCAGGG - Intronic
1084251332 11:67901639-67901661 GAGGCCTCATCATGTTGCCCAGG + Intergenic
1084393795 11:68895869-68895891 GAGGTCTCACCATGTTGCCCAGG + Intronic
1084517403 11:69644287-69644309 GTGGCCACTCCATGCTGAAAGGG + Intronic
1084554896 11:69869644-69869666 CAGGCCCCACTCTGCTGCCATGG - Intergenic
1084821509 11:71694394-71694416 GAGGCCTCATCATGTTGCCCAGG - Intergenic
1084951490 11:72668597-72668619 AAATCCACACCCTGCTGCCAAGG - Intronic
1085305716 11:75484691-75484713 GAGGTCTCACCATGTTGCCCAGG - Intronic
1085680404 11:78569344-78569366 CAGGTCTCACCATGCTGTCAAGG + Intronic
1086945777 11:92842678-92842700 GAGGCCTCACTATGTTGCCAAGG - Intronic
1086977179 11:93147174-93147196 GAGGTCTCACTATGCTGCCCAGG + Exonic
1088216437 11:107515546-107515568 AAGGTCTCACCATGCTGCCCAGG + Intronic
1088278127 11:108110633-108110655 GGGGCCTCACTATGCTGCCCAGG - Intergenic
1088430408 11:109752383-109752405 GTGGCAACACGATACTGCCAAGG + Intergenic
1088880573 11:113970459-113970481 GAGGTCTCACCATGTTGCCCAGG + Intergenic
1089482617 11:118819231-118819253 GAGGTCTCACCATGTTGCCCAGG - Intergenic
1089961453 11:122620692-122620714 GAGGTCTCACCATGTTGCCCAGG - Intergenic
1090043484 11:123311040-123311062 GAGGTCTCACTATGCTGCCCAGG + Intergenic
1090262033 11:125328137-125328159 GAGGCCACACCAGGCAGGCAGGG + Intronic
1090281804 11:125462805-125462827 GAGGTTTCACCATGCTGCCCAGG - Intronic
1090435416 11:126683045-126683067 GAGGTCTCACCATGTTGCCTAGG + Intronic
1090447165 11:126774380-126774402 GAGGCCCCACTCTCCTGCCACGG - Intronic
1091760149 12:3081772-3081794 GAGGCCTCACTATGTTGCCCAGG - Intronic
1092345025 12:7707720-7707742 GGGGTCTCACTATGCTGCCAAGG + Intergenic
1092466683 12:8739663-8739685 GAGGTCACACCATGTTGCTCAGG + Intronic
1092547456 12:9464623-9464645 GTGGCCACACCTAGCTGCAAGGG + Intergenic
1093459842 12:19398028-19398050 GGGGTCTCACCATGTTGCCAAGG - Intergenic
1094207310 12:27854090-27854112 GAGGCCCCACTATGTTGCCCAGG + Intergenic
1094505537 12:31057741-31057763 GTGGCCACACCTAGCTGCAAGGG - Intergenic
1094631484 12:32179797-32179819 GAGGCTTCACCATGCTGGCCAGG - Intronic
1094768200 12:33621786-33621808 GAGGTCTCACTACGCTGCCAAGG - Intergenic
1095084793 12:38049596-38049618 GAGGTTTCACCATGTTGCCAAGG - Intergenic
1095346465 12:41155702-41155724 GGGGTTTCACCATGCTGCCAAGG + Intergenic
1095771080 12:45958094-45958116 GAGGTCTCACCATGTTGCCCAGG + Intronic
1096095411 12:48932302-48932324 GGGGCCTCACCATGTTGCCCAGG + Intronic
1096388329 12:51210143-51210165 GAGGTCTCACTATGTTGCCAGGG + Intronic
1096584095 12:52608331-52608353 GGGGCTACAGCATGCTGCCTGGG - Exonic
1097130901 12:56810142-56810164 GAGGCCCCACCTTGAGGCCAGGG - Intergenic
1097692344 12:62745251-62745273 GAGGCCTCACTATGTTGCCTAGG + Intronic
1097806171 12:63967247-63967269 GAGGCCTCACTATGTTGCCAAGG - Intronic
1098222087 12:68280973-68280995 GGGGCCTCACCATGTTGCCCAGG + Intronic
1100502694 12:95189453-95189475 GGGGCTTCACCATGTTGCCAAGG - Intronic
1101124238 12:101614582-101614604 GAGGCCAAATCATGCTGGGATGG - Intronic
1101448688 12:104756736-104756758 GAGGTCTCACTATGTTGCCAAGG + Intronic
1101894912 12:108749074-108749096 GAGGTCTCACTATGTTGCCAGGG - Intergenic
1102065412 12:109970975-109970997 GAGGTCTCACCATGCTGCCCAGG + Intronic
1102198729 12:111042825-111042847 GAGGTCTCACCATGCTACCCAGG + Intronic
1102223703 12:111212558-111212580 GAGGCCTCACTATGTTGCCCAGG + Intronic
1102227157 12:111236955-111236977 GAGGTCTCATCATGTTGCCAAGG - Intronic
1102467749 12:113139946-113139968 GAGGCCTCACTATGCTGCCCAGG - Intergenic
1102831866 12:116009869-116009891 GAGCCCACTACATGATGCCAAGG + Intronic
1103302089 12:119935704-119935726 GGGGTCTCACCATGTTGCCAGGG - Intergenic
1103639422 12:122337478-122337500 GGGGTCTCACCATGCTGCCCAGG + Intronic
1103676125 12:122657243-122657265 GAGGTCTCACCATGTTGCCCAGG - Intergenic
1103780057 12:123392464-123392486 GAGGCCTCACTATGTTGCCCAGG - Intronic
1104438160 12:128772733-128772755 GAGGCCTCACTATGTTGCCCAGG + Intergenic
1104935844 12:132364037-132364059 GAGGCCACAGCATGGGGACAGGG - Intergenic
1105495133 13:20923801-20923823 GAGGTCTCACCATGCTGCCCAGG - Intergenic
1105674540 13:22656445-22656467 GAGGTTTCACCATGCTGCCCAGG + Intergenic
1106191795 13:27459817-27459839 GAGGTTTCACCATGTTGCCAAGG - Intergenic
1106222770 13:27760487-27760509 GAGGTCTCACCATGTTGCAATGG + Intergenic
1106248837 13:27969026-27969048 CAGACCTCACCATGCTGCCTGGG + Exonic
1107018489 13:35728370-35728392 GAGGTTTCACCATGCTGCCCAGG - Intergenic
1107622396 13:42246393-42246415 GAGGCCTCACTATGTTGCCTGGG - Intronic
1107695354 13:42994188-42994210 GAGGTCTTACCATGCTGCCCAGG - Intergenic
1107874342 13:44776871-44776893 GGGGCCTCACCATGTTGCCCAGG + Intergenic
1108060039 13:46523786-46523808 GGGGCCTCACCATGTTGCCTAGG - Intergenic
1108150529 13:47529025-47529047 GAGGCCTCACTATGTTGCCCAGG + Intergenic
1108347765 13:49563206-49563228 GAGGTCTCACCATGTTGCCTAGG - Intronic
1108586442 13:51874158-51874180 GAGCCCACACCCTGCTGCAGGGG + Intergenic
1109753746 13:66730914-66730936 GAGGTCTCACTATGCTGCCGAGG + Intronic
1110114350 13:71793716-71793738 GAGGTCTCACTATGCTGCCCAGG + Intronic
1110443942 13:75555782-75555804 GAGGTCACACTATGTTGCCCAGG + Intronic
1111237785 13:85431349-85431371 GAGGCCACACCTTCAAGCCAGGG + Intergenic
1111668722 13:91301840-91301862 GAGGTCTCACTATGCTGCCCAGG + Intergenic
1112305177 13:98267212-98267234 CAGTCTGCACCATGCTGCCACGG - Intronic
1112371941 13:98802007-98802029 GAGTCCTCACCATCCTACCAGGG - Intronic
1112514253 13:100038111-100038133 GAGGTCTCACCATGTTGCCCAGG - Intergenic
1112551771 13:100428257-100428279 GAGGCCTCACTATGTTGCCCAGG + Intronic
1112640601 13:101269681-101269703 GAAGCCACACCATTCTGCTTTGG + Intronic
1113994014 14:16052555-16052577 GAGGTTTCACCATGTTGCCAAGG + Intergenic
1114756864 14:25269486-25269508 GAGGCCTCACCAAGCTCCCATGG + Intergenic
1114836828 14:26212472-26212494 CAGGCCACACTAAGATGCCAGGG - Intergenic
1115596852 14:34917673-34917695 GAGGTCACACTATGTTGCCCAGG - Intergenic
1115608794 14:35032637-35032659 GAGGCCTCCCTATGTTGCCAAGG - Intergenic
1115687929 14:35815918-35815940 GGGGTCTCACCATGCTGCCTAGG + Intergenic
1116871127 14:50069993-50070015 GAGGTCTCACTATGCTGCCCAGG - Intergenic
1117686529 14:58259121-58259143 GGGGTCTCACCATGCTGCCCAGG + Intronic
1117774489 14:59168738-59168760 GGGGCCACACTATGCTGCCTGGG - Intergenic
1117870970 14:60199653-60199675 GGGGCCTCACTATGCTGCCCAGG - Intergenic
1118221327 14:63856959-63856981 GAGGTCTCACCATGTTGCCTAGG + Intronic
1118327110 14:64788708-64788730 GAGGCCACACCAAGATGCACTGG + Intronic
1118500165 14:66354999-66355021 GAGGCCTCACTATGTTGCCCAGG + Intergenic
1118627044 14:67669456-67669478 TAGGTCTCACCATGTTGCCAAGG + Intronic
1118633313 14:67725502-67725524 GTGGCCACACCTTGATGCCAAGG - Intronic
1118870217 14:69735159-69735181 GGGGTCTCACCATGTTGCCAAGG + Intronic
1118884017 14:69851720-69851742 AAGGCCACAGTATGCTGCAAAGG - Intergenic
1119065739 14:71524638-71524660 GAGGTCTCACTATGTTGCCAAGG + Intronic
1119324414 14:73751312-73751334 GAGGTCACACCAGGCTGCCTGGG + Intronic
1119451965 14:74719426-74719448 GCGGTCACACCATGTTGCCCAGG - Intronic
1119452542 14:74724475-74724497 GAGGTCTCACCATGTTGCCCAGG + Intronic
1119701167 14:76755780-76755802 GAGGCCACACCAGGCTGCCCGGG + Intergenic
1119816154 14:77570006-77570028 GAGGCCTCACTATGTTGCCCAGG + Intronic
1119867494 14:77986048-77986070 GAGGTCTCACTATGTTGCCAAGG + Intergenic
1120011610 14:79422253-79422275 GAGGTCTCACCATGTTGCCTAGG + Intronic
1120866867 14:89302629-89302651 CAGGCCACACACCGCTGCCAAGG + Intronic
1121039361 14:90732567-90732589 GAGGTTTCACCATGCTGCCCAGG + Intronic
1121115989 14:91343145-91343167 GAGGTCTCACTATGTTGCCAAGG + Intronic
1122153875 14:99738819-99738841 GAGGCCAGACCTGGCTGCCTGGG - Intronic
1122256521 14:100481728-100481750 GAGTCCACACAATTCTGACAGGG - Intronic
1122386589 14:101352418-101352440 GAGGTCTCACTATGCTGCCCAGG - Intergenic
1122471282 14:101968423-101968445 GAGGTCTCACCATGTTGCCCAGG + Intronic
1122498057 14:102173303-102173325 GAGGTCTCACCATGTTGCCCAGG + Intronic
1122609180 14:102969616-102969638 CAGGCCACGCCATACTGCCAAGG + Intronic
1122615122 14:103011922-103011944 GAGGTCTCACCATGTTGCCCAGG - Intronic
1122710015 14:103649535-103649557 GAGGTCTCACCATGTTGCCCAGG - Intronic
1122890540 14:104730149-104730171 GAGGCCACACCTGCCTGCCCAGG + Exonic
1123490312 15:20775294-20775316 GAGGCCACTCCCTGCAGTCAGGG - Intergenic
1123546813 15:21344381-21344403 GAGGCCACTCCCTGCAGTCAGGG - Intergenic
1123705194 15:22946109-22946131 GAGGTCTCACCATGTTGCCCAGG - Intronic
1123727517 15:23119126-23119148 GAGGTCTCACCATGTTGCCCAGG - Intergenic
1124155037 15:27218213-27218235 GAGGTCTCACCATGTTGCCCAGG + Intronic
1124631072 15:31337602-31337624 GAGGCTACACCATACAGCCTAGG - Intronic
1124805631 15:32879288-32879310 GAGTCCTGACCATGTTGCCATGG - Intronic
1124961233 15:34397172-34397194 GAGTTCTCACCATGCTGCCCAGG + Intronic
1124977863 15:34543396-34543418 GAGTTCTCACCATGCTGCCCAGG + Intronic
1125316314 15:38435655-38435677 GAGGCCTCACTATGTTGCCTAGG + Intergenic
1125386124 15:39138702-39138724 GGGGCCTCACTATGTTGCCAAGG + Intergenic
1125540793 15:40468928-40468950 AAGGCCACATCATGGGGCCAAGG + Intergenic
1125651096 15:41318485-41318507 GAGGCTTCACCATGTTGCCTAGG + Intronic
1125756288 15:42067342-42067364 GAGGTCTCACCATGTTGCCCAGG - Intronic
1126129266 15:45324707-45324729 GGGGCTTCACCATGCTGCCCAGG + Intergenic
1126146593 15:45479227-45479249 GAGGTTTCACCATGTTGCCAAGG + Intergenic
1126152935 15:45539420-45539442 TAGGCCACAGCCTGCTGCCTGGG + Intergenic
1126330779 15:47528718-47528740 TAGGCCACATCCAGCTGCCAGGG + Intronic
1126974422 15:54158842-54158864 GAGGTCTCACTATGCTGCCCAGG + Intronic
1127984162 15:64055952-64055974 GAGGTCTCACTATGTTGCCAAGG - Intronic
1128039218 15:64555470-64555492 GAGGTTTCACCATGCTGCCCAGG - Intronic
1128177303 15:65567129-65567151 GGGGTCTCACTATGCTGCCAAGG - Intronic
1129405856 15:75317189-75317211 GAGGCCTCACTATGTTGCCCAGG + Intergenic
1129704986 15:77789014-77789036 GAGGCCGCCCCAAGCTGTCAGGG - Intronic
1129914050 15:79252800-79252822 GAGGTCTCACCATGTTGCCCAGG + Intergenic
1130074927 15:80680397-80680419 GAGGTCTCACCATGTTGCCCAGG - Intronic
1130953314 15:88609462-88609484 GTGGCCACTCCATGTTACCATGG - Intergenic
1131005574 15:88974814-88974836 GAGGTCTCACCATGTTGCCAAGG - Intergenic
1131018389 15:89076673-89076695 GAGGTCTCACCATGTTGCCCAGG + Intergenic
1131240049 15:90731889-90731911 GAGGTTTCACCATGTTGCCAAGG + Intronic
1132109680 15:99093519-99093541 GAGGCCTCACTATGTTGCCCAGG + Intergenic
1132226348 15:100144807-100144829 GAGGCCTCTCCCTCCTGCCAGGG + Intronic
1202955145 15_KI270727v1_random:71597-71619 GAGGCCACTCCCTGCAGTCAGGG - Intergenic
1132543110 16:520610-520632 CAGGCCACACCGTGCAGACACGG - Intronic
1132882020 16:2166591-2166613 GAGGTCTCACCATGTTGCCCAGG + Intronic
1133016085 16:2941423-2941445 GAGGTCTCACCATGTTGCCCAGG - Intronic
1133035809 16:3033587-3033609 GAGGTCTCACCATGTTGCCCAGG - Intronic
1133110672 16:3546204-3546226 GGGGCCTCACCATGTTGCCCAGG - Intronic
1133262236 16:4558420-4558442 GAGGTCTCACTACGCTGCCAAGG - Intronic
1133684256 16:8150687-8150709 GGGGTCTCACCATGTTGCCATGG - Intergenic
1133867687 16:9659338-9659360 GAGGTTTCACCATGTTGCCAAGG - Intergenic
1134185322 16:12080569-12080591 GAGGTCTCACCATGCTGTCCAGG + Intronic
1134203323 16:12216891-12216913 GAGGCCACAGCTAGCTGCAAGGG + Intronic
1134538952 16:15048948-15048970 GAGGCCTCCCTATGCTGCCCAGG + Intronic
1134676283 16:16092796-16092818 GAGGTTTCACCATGCTGCCCAGG - Intronic
1135171834 16:20191142-20191164 GAGGTCTCACCATGTTGCCCAGG - Intergenic
1135352403 16:21740041-21740063 GAGGTCTTACCATGCTGCCCAGG + Intronic
1135450891 16:22556163-22556185 GAGGTCTTACCATGCTGCCCAGG + Intergenic
1136274243 16:29169037-29169059 GTGGCAACACCCTGCTGTCAGGG - Intergenic
1136710636 16:32234048-32234070 GAGCCCACACCATCCTGGGATGG - Intergenic
1136757275 16:32695363-32695385 GAGCCCACACCATCCTGGGATGG + Intergenic
1136810833 16:33175012-33175034 GAGCCCACACCATCCTGGGATGG - Intergenic
1136817309 16:33285092-33285114 GAGCCCACACCATCCTGGGATGG - Intronic
1136823872 16:33341621-33341643 GAGCCCACACCATCCTGGGATGG - Intergenic
1137223661 16:46481569-46481591 GGGGTCACACAATCCTGCCAGGG + Intergenic
1137225631 16:46504899-46504921 GGGGCATCACCATGCTGCCTAGG + Intergenic
1137288658 16:47037252-47037274 GAGGTCTCACCATGTTGCCCAGG + Intergenic
1137377415 16:47964801-47964823 TAGGCCACACCATACAGCCTAGG + Intergenic
1137439567 16:48486345-48486367 GAGGTCTCACCATGTTGCCAAGG + Intergenic
1137579577 16:49625573-49625595 GAGGGCACCCCTAGCTGCCAAGG + Intronic
1137654696 16:50150227-50150249 GAGGTCTCACCATGTTGCCTAGG + Intergenic
1138009747 16:53367106-53367128 GAGGTCTCACCATGTTGCCTGGG + Intergenic
1138084212 16:54119026-54119048 AAAGCCACAGCAGGCTGCCAGGG + Exonic
1138265764 16:55658318-55658340 GAGGTCTCACCATGTTGCCCAGG - Intronic
1138482917 16:57315919-57315941 GAGGTCTCACCATGTTGCCCAGG - Intergenic
1138579761 16:57933117-57933139 GAGGTCTCACCATGTTGCCCAGG + Intronic
1138860192 16:60746319-60746341 GAGGCCACACTATGTTGTGAAGG - Intergenic
1138902274 16:61287298-61287320 GAGGTCTCACCATGTTGCCCAGG - Intergenic
1139430319 16:66907660-66907682 GGGGCCTCACCATCCTGCCCAGG + Intergenic
1139443752 16:66983691-66983713 AAGGTTTCACCATGCTGCCAAGG + Intergenic
1139725957 16:68898529-68898551 GGGGTCTCACCATGTTGCCAAGG + Intronic
1140250761 16:73292392-73292414 AAAGCCACAGAATGCTGCCATGG - Intergenic
1140416307 16:74775992-74776014 GAGGTTTCACCATGCTGCCCAGG + Intergenic
1140862136 16:79027086-79027108 GGGGTCTCACCATGTTGCCAAGG - Intronic
1141122935 16:81375772-81375794 GAGGTCTCACCATGCTACCCAGG - Intronic
1141391855 16:83671438-83671460 GAGGTCTCACCATGTTGCCCAGG + Intronic
1142078525 16:88134684-88134706 GTGGCAACACCCTGCTGTCAGGG - Intergenic
1142301321 16:89260076-89260098 GAGGCCTCACTATGTTGCCCAGG - Intergenic
1142340859 16:89521548-89521570 GAGGTCTCACTATGTTGCCAAGG - Intronic
1203059425 16_KI270728v1_random:955714-955736 GAGCCCACACCATCCTGGGATGG + Intergenic
1142588514 17:989567-989589 GAGGTCTCACTATGCTGCCCAGG + Intergenic
1143194903 17:5068578-5068600 CAGGCCTCACCATGATGCCCAGG - Intergenic
1143782132 17:9234438-9234460 GAGGCCACTCCTGGCTGCCCTGG + Intronic
1144655347 17:17031638-17031660 GAGGTCTCACCATGCTGTCCGGG + Intergenic
1144762755 17:17716747-17716769 GAGGCCCCTCCATCCTGCCCTGG - Intronic
1144809185 17:17987817-17987839 GAGCCAGCACCAAGCTGCCAGGG - Intronic
1145354937 17:22134737-22134759 GGGGCTACACCATGCTGGCCAGG - Intergenic
1146316012 17:31807412-31807434 GAGGCCACACTATGTTGCCTAGG + Intergenic
1146699124 17:34938672-34938694 GAGGTTTCACCATGTTGCCAAGG - Intronic
1147018560 17:37512283-37512305 GAGGTCACAGCACGCTACCAAGG + Exonic
1147349287 17:39827497-39827519 GAGGCCTCACCATGTTGCCCAGG + Intronic
1147391970 17:40114982-40115004 GGGGCCTCACCATGTTGCCCAGG - Intergenic
1147609107 17:41791313-41791335 GAGGTCTCACCATGTTGCCCAGG + Intergenic
1147897664 17:43761357-43761379 TAGGCCTCACCATGTTGCCCAGG - Intergenic
1147935654 17:44009303-44009325 GAGGTCTCACTATGTTGCCAAGG + Intergenic
1148033044 17:44635540-44635562 GAGGCCTCACTATGTTGCCCAGG - Intergenic
1148389501 17:47260729-47260751 GAGAACAGACCATGCTGCCCTGG + Intronic
1148490570 17:48021318-48021340 GAGGTCTCACCATGTTGCCCAGG - Intergenic
1148653799 17:49268423-49268445 GAGGCCACATCTTTCTGCCCAGG - Intergenic
1148832066 17:50440235-50440257 GAGGCCACCCCCTGCTTCCTGGG - Intronic
1148901202 17:50878865-50878887 GGGGTCACACCATGTTGCCCAGG - Intergenic
1148906780 17:50917376-50917398 GAGGCCACTCAATGCTGCGCTGG + Intergenic
1149882937 17:60310842-60310864 GAGGTCTCACCATGTTGCCCAGG - Intronic
1150369508 17:64624628-64624650 GAGGTCTCACCATGTTGCCCAGG - Intronic
1151288166 17:73128507-73128529 GAGCCCAATCCCTGCTGCCAAGG + Intergenic
1151511052 17:74560444-74560466 GAGGTCTGACCATGCTGCCCAGG + Intergenic
1151720419 17:75852225-75852247 GAGGTCTCACCATGTTGCCCAGG - Intronic
1151916702 17:77123606-77123628 GAGGTCTCACCATGTTGCCCAGG + Intronic
1151995496 17:77606184-77606206 GAGCCCTCACAATGCTCCCAGGG - Intergenic
1152137584 17:78513902-78513924 GAGGCCCCACCTAGCTGCAAAGG - Intronic
1152402532 17:80076380-80076402 GAGGTCTCACCATGTTGCCCAGG - Intronic
1152500599 17:80706219-80706241 GGGGCCACACCAGGCAGTCAGGG - Intronic
1152856791 17:82669144-82669166 GAGGTCTCACCATGTTGCCCAGG - Intronic
1153288826 18:3480767-3480789 GAGGTCTCACCATGTTGCCCAGG + Intergenic
1153701396 18:7697722-7697744 GAGGCTACACCAACCTGGCATGG + Intronic
1153901693 18:9622685-9622707 GGGGCCGCACCATGTTGCCTAGG - Intergenic
1154447918 18:14450051-14450073 GAGGCCACTCCCTGCAGTCAGGG - Intergenic
1155120490 18:22814701-22814723 GAGGTCTCACCATGTTGCCCAGG + Intronic
1155202849 18:23532625-23532647 GAGGCCTCACTATGTTGCCTAGG + Intronic
1155492230 18:26410564-26410586 GATGCCTCACCATGTTGCCCAGG - Intergenic
1156424333 18:36992910-36992932 GAGGTTTCACCATGCTGCCCAGG - Intronic
1156495045 18:37520097-37520119 GAGGCCATCCCATGCTACCAGGG + Intronic
1157320475 18:46630290-46630312 GAGCCCACACCATACTGCCTGGG - Intronic
1157477289 18:48031468-48031490 GAGACCACAGCATGCTGGTAGGG - Intronic
1159544697 18:69824550-69824572 GAGGTCTCACCATGTTGCCCAGG + Intronic
1159753204 18:72328432-72328454 GAGGCCATGCCATGTTGCCCAGG + Intergenic
1159965221 18:74588408-74588430 TAGGCCACACCATGCTGCCTAGG + Intergenic
1161535268 19:4815612-4815634 GCGGTCTCACCATGCTGCCCAGG + Intergenic
1161569256 19:5021400-5021422 CAGGTCTCACCATGCTGCCCAGG - Intronic
1161853683 19:6752206-6752228 GAGGTCTCACCATGTTGCCCTGG + Intronic
1161925718 19:7297620-7297642 GAGGTCTCACCATGTTGCCCAGG + Intergenic
1162089340 19:8268791-8268813 CTCTCCACACCATGCTGCCAGGG - Intronic
1162447113 19:10730283-10730305 GAGGTCTCACCATGTTGCCCAGG - Intronic
1162585340 19:11554748-11554770 GAGGCCTCACTATGTTGCCCAGG - Intronic
1162860745 19:13504733-13504755 GGGGACACACCCTGCTGCCCAGG - Intronic
1162920851 19:13901845-13901867 GAGGCCTCACTATGTTGCCCAGG - Intronic
1163135278 19:15306460-15306482 GAGGCCTCACTATGTTGCCCAGG + Intronic
1163136995 19:15319142-15319164 GAGGTCACACTATGTTGCCCAGG - Intronic
1163278322 19:16299870-16299892 GAGGGCACTCCATGTTGCCCTGG - Intergenic
1163411055 19:17154767-17154789 GAGGTCTCACTATGCTGCCCAGG - Intronic
1163436958 19:17301605-17301627 CAGGACACACCATGCTGACCGGG - Exonic
1163555462 19:17989899-17989921 GAGGCCACACAGAGCTGCGAGGG - Intronic
1163568015 19:18063287-18063309 GAGGTCTCACCATGTTGCCCAGG + Intronic
1163804921 19:19389953-19389975 GAGGTCTCACCATGTTGCCCAGG + Intronic
1164894242 19:31856638-31856660 GAGGTCTCACTATGCTGCCCAGG - Intergenic
1164945028 19:32286203-32286225 GAGGTCTCACTATGTTGCCAAGG - Intergenic
1165733733 19:38162917-38162939 GTGGCCACACCTAGCTGCAAGGG + Intronic
1165820899 19:38675424-38675446 GAGGTCTCACCATGTTGCCCAGG + Intronic
1165840431 19:38786093-38786115 GAGGTCTCACCATGTTGCCCAGG - Intergenic
1166229627 19:41418729-41418751 GAGGCCTCACCATGTTGCTCAGG + Intronic
1166397293 19:42450905-42450927 GAGGTCTCACCATGTTGCCCAGG - Intergenic
1166670327 19:44705908-44705930 GAGGCCTCATCAGGCTGCGAAGG + Intronic
1167041551 19:47025764-47025786 GAGGTCTCACCATGTTGCCCAGG + Intronic
1167066230 19:47188155-47188177 GAGGTCTCACCATGTTGCCCAGG - Intronic
1167602420 19:50462023-50462045 GAGGCCACCCGAAGGTGCCAGGG + Exonic
1167759014 19:51432044-51432066 GAGGTCTCACCATGTTGCCCAGG + Intergenic
1168138772 19:54370374-54370396 GAGCCCAGGCCAGGCTGCCAAGG - Intronic
1168150100 19:54441971-54441993 GAGGTCTCACCATGTTGCCCAGG + Intergenic
1168159251 19:54498123-54498145 GAGCCCAGGCCAGGCTGCCAAGG + Intronic
1168498261 19:56872222-56872244 GGGGCCTCACTATGCTGCCCAGG - Intergenic
1168674290 19:58265777-58265799 GAGGTCTCACCATGTTGCCCAGG + Intronic
925161270 2:1685794-1685816 GAGGACACCCCAGGCTGCCTGGG - Intronic
926067347 2:9853657-9853679 GAGGTCTCACCATGTTGCCCAGG + Intronic
927572366 2:24170895-24170917 GAGGTCTCACCATGTTGCCCAGG + Intronic
927587161 2:24318335-24318357 GGGGTCTCACTATGCTGCCAAGG + Intronic
928014713 2:27645160-27645182 GAGGTCTCACCATGTTGCCCAGG + Intronic
928577514 2:32670067-32670089 GAGGCTTCACCATGCTGGCCAGG + Intronic
929160730 2:38829608-38829630 GAGGTCTCACTATACTGCCAAGG + Intronic
929211981 2:39367348-39367370 GAGGTCTCACCATGTTGCCCAGG - Intronic
929520338 2:42644415-42644437 GAGGCCTCGCTATGTTGCCAAGG + Intronic
929702693 2:44178109-44178131 GAGGTTTCACCATGCTGCCCAGG + Intronic
929815346 2:45226421-45226443 GAGGTCTCACCATGGTGCCCAGG + Intergenic
930037446 2:47095781-47095803 GCAGCCACACCTAGCTGCCAGGG - Intronic
930515201 2:52398465-52398487 GAGGTCTCACTATGTTGCCAAGG + Intergenic
931259748 2:60606998-60607020 GAGGTCTCACTATGTTGCCAGGG + Intergenic
931913005 2:66922646-66922668 GAAGCCATACAATGCTGCCAAGG - Intergenic
931995055 2:67831758-67831780 GGGGTCTTACCATGCTGCCAAGG + Intergenic
932318549 2:70802791-70802813 GAGGTCTCACCATGTTGCCTAGG - Intergenic
932387100 2:71345571-71345593 GAGGTCTCACCATGTTGCCCAGG + Intronic
933749193 2:85592286-85592308 GAGGTCTCACCATGTTGCCCAGG + Intronic
933789309 2:85871227-85871249 GAGGTCTCACTATGCTGCCAAGG + Intronic
934765618 2:96878535-96878557 GAGGGCACGCCATGCTGCCCTGG - Intronic
935437304 2:103048639-103048661 GAGGTCTCACTATGCTGCCCAGG + Intergenic
935694974 2:105763238-105763260 TAGCCCTCACCATTCTGCCAAGG + Intronic
935884161 2:107597563-107597585 GAGGTCTCACCATGTTGCCCAGG + Intergenic
936101309 2:109582511-109582533 GAGGTCCCACCATGTTGCCCAGG + Intronic
936281809 2:111147903-111147925 GAGGCCATGCCCTGCTCCCACGG - Intronic
936438404 2:112528798-112528820 GAGGGCACTCCCTGCTGCCTTGG + Exonic
936583634 2:113730623-113730645 GAGGTCTCACTATGCTGCCCAGG + Intronic
937159492 2:119746733-119746755 GTGGCCACACCTTGATGCAAGGG - Intergenic
937263152 2:120599144-120599166 TGGGCCACACCTTGCTGTCAAGG - Intergenic
937595233 2:123664210-123664232 GAGGTCTCACTATGTTGCCAAGG + Intergenic
938537655 2:132258315-132258337 GAGGTTTCACCATGTTGCCAAGG - Intergenic
938657471 2:133448829-133448851 GAGGTCTCACCATGTTGCCCAGG + Intronic
939094025 2:137811976-137811998 AAGGCCACACCATGTTCACATGG - Intergenic
939309154 2:140451131-140451153 GAGGTTTCACCATGTTGCCAAGG + Intronic
939982156 2:148795065-148795087 GAAGTCACACCATGTTGCCCAGG - Intergenic
940547638 2:155109350-155109372 GAGGCCACACCAAAGAGCCAGGG - Intergenic
941605484 2:167591663-167591685 GAGGTCACACTATGTTGCCCTGG + Intergenic
941746697 2:169094570-169094592 GAGGTCACACTATGGTGCCCAGG + Intronic
941765550 2:169292624-169292646 GAGGTCTCACCATGTTGCCCAGG - Intronic
941880157 2:170472890-170472912 GAGGTCTCACCATGTTGCCCAGG + Intronic
941910405 2:170759031-170759053 CAGGCCATACCATGCAGCCTAGG + Intergenic
942264372 2:174206339-174206361 GAGGTCTCACCATGTTGCCTAGG - Intronic
943308826 2:186301274-186301296 GAGGTTTCACCATGTTGCCAAGG - Intergenic
944052219 2:195483159-195483181 GAGGTCTCACCATGTTGCCCAGG - Intergenic
944052838 2:195490932-195490954 GAGGTCTCACTATGCTGCCCAGG + Intergenic
945744001 2:213698451-213698473 GAGGTCTCACCATGTTGCCCAGG + Intronic
946662298 2:222014628-222014650 GTGGCCTCACCATGTTGCCCAGG + Intergenic
948143853 2:235693660-235693682 GAGGCCTCACTATGTTGCCCAGG - Intronic
948730291 2:239959224-239959246 GAGTCCACACCATGCCGACACGG + Exonic
1168818723 20:759268-759290 GAGGTCTCACCATGTTGCCCAGG - Intergenic
1169355813 20:4904100-4904122 GAGGCCTCACTATGTTGCCCAGG - Intronic
1169362033 20:4958617-4958639 GAGGTTTCACCATGATGCCAAGG + Intronic
1169450340 20:5705532-5705554 GAGATCACACCATGTTGCCCAGG - Intergenic
1169453116 20:5729113-5729135 GAGGTCTCACTATGCTGCCCAGG + Intergenic
1170513340 20:17102120-17102142 GAGGTCTCGCCATGCTGCCCAGG - Intergenic
1170656904 20:18295853-18295875 GAGGTCTCACCATGTTGCCCAGG + Intronic
1170869390 20:20190925-20190947 GAGGTTACACCATGTTGCCCAGG - Intronic
1171057980 20:21926427-21926449 GGGGCCTCACCATGGTGCCCAGG - Intergenic
1171332552 20:24353611-24353633 GAGGTCTCACCATGTTGCCCAGG + Intergenic
1171485244 20:25481323-25481345 GAGGCCACCCCATCCTCCAAAGG + Intronic
1171500101 20:25586370-25586392 GAGGCTTCACCATGTTGCCCAGG + Intergenic
1171768416 20:29302256-29302278 GAGGTTTCACCATGTTGCCAAGG - Intergenic
1171811114 20:29744503-29744525 GAGGTTTCACCATGTTGCCAAGG - Intergenic
1171866565 20:30490098-30490120 GAGGTTTCACCATGTTGCCAAGG - Intergenic
1171908558 20:30921220-30921242 GAGGTTTCACCATGTTGCCAAGG + Intergenic
1172237058 20:33384708-33384730 GAGGTCTCACTATGCTGCCCAGG - Intronic
1172442532 20:34976346-34976368 GAGGCCAGACCAGGCTCACACGG - Intronic
1172462466 20:35130259-35130281 GAGGTCTCACCATGTTGCCCAGG + Intronic
1172551719 20:35805669-35805691 GAGGTCTCACTATGTTGCCAAGG + Intronic
1172558535 20:35865307-35865329 GAGGTCTCACTATGTTGCCAAGG - Intronic
1173598048 20:44272493-44272515 GAGGGCACTCCGTGCTGCCCAGG - Intronic
1173815448 20:45984818-45984840 GAGGTCTCACCATGTTGCCTAGG + Intergenic
1174401969 20:50280801-50280823 GAAGCCAGACCCTGCAGCCAGGG + Intergenic
1174464876 20:50709707-50709729 GAGGTCTCACCATGTTGCCCAGG - Intergenic
1174544405 20:51314508-51314530 GGGGCCACACTCTGCTCCCAGGG + Intergenic
1174622444 20:51886207-51886229 GAAGCCACACGCTGCAGCCATGG + Intergenic
1174821516 20:53730478-53730500 GAGGTCTCACCATGTTGCCCAGG + Intergenic
1175754842 20:61522960-61522982 CAGGCCACATCCTGATGCCAGGG - Intronic
1176448299 21:6840625-6840647 GTGGCCACACCCTGCAGTCAGGG + Intergenic
1176826469 21:13705647-13705669 GTGGCCACACCCTGCAGTCAGGG + Intergenic
1177147548 21:17422823-17422845 GAGGTCTCACTATGCTGCCCAGG + Intergenic
1177429978 21:20979658-20979680 AAAGCCATGCCATGCTGCCAGGG + Intergenic
1178129043 21:29549056-29549078 GAGGTCCCACCATGTTGCCCAGG + Intronic
1178433305 21:32535449-32535471 GAGGTCCCACTATGTTGCCAAGG - Intergenic
1178474695 21:32927439-32927461 GGGGGCTCACTATGCTGCCAAGG - Intergenic
1178616622 21:34139767-34139789 GAGGCTTCACCATGTTGCCCAGG + Intronic
1178976877 21:37227817-37227839 GAGGCCACATCACGCGGTCAGGG + Intronic
1179185208 21:39080560-39080582 GTGGCTCCACCGTGCTGCCAGGG + Intergenic
1179885194 21:44310866-44310888 GAGGCCCCACCATCATCCCAGGG - Intronic
1179924629 21:44527688-44527710 GAGGCCACTCACTGCTGCCAGGG + Intronic
1180313254 22:11254960-11254982 GAGGTTTCACCATGTTGCCAAGG - Intergenic
1180341991 22:11627405-11627427 GAGGTTTCACCATGTTGCCAAGG + Intergenic
1180894913 22:19323538-19323560 GAGGTCTCACCATGTTGCCCAGG - Intergenic
1180987107 22:19911586-19911608 GAGGCCACAGCCTGCAGACAAGG - Intronic
1181503317 22:23332653-23332675 GAGGCCTCACTATGTTGCCCAGG - Intergenic
1181615661 22:24052596-24052618 GAGGTCTCACTATGCTGCCCAGG - Intronic
1181691572 22:24565268-24565290 GAGGTCACACCACGCTTACATGG - Intronic
1182459351 22:30472880-30472902 TAGCCCACACCATTCTGCCTAGG + Intergenic
1182612968 22:31564699-31564721 GAGGTCTCACCATGTTGCCCAGG + Intronic
1182617789 22:31600077-31600099 GAGGTCTCACTATGCTGCCCAGG + Intronic
1182660901 22:31924430-31924452 GAGGCCTCACTATGTTGCCAAGG - Intergenic
1183342947 22:37292082-37292104 GTGGCCACACCTAGCTGCAAGGG - Intronic
1183684598 22:39354444-39354466 CAGGCCACCCCTTGGTGCCATGG - Intronic
1183769020 22:39907543-39907565 GGGGCCTCACCATGTTGCCCAGG - Intronic
1183831875 22:40422554-40422576 GAGGCCACTCACTGCTCCCAAGG + Intronic
1183968157 22:41455913-41455935 GGGGCCTCACTATGTTGCCAAGG + Intergenic
1184083742 22:42245273-42245295 GAGGTCTCACTATGCTGCCCAGG + Intronic
1184330390 22:43823546-43823568 GAGGCCCCCCCATTCTTCCACGG + Intergenic
1184368024 22:44064787-44064809 GAGGCCACAGCAAGCTGTGATGG + Intronic
1184430641 22:44439967-44439989 GAGGCCAGACCTTGCTCCCAGGG - Intergenic
1184885781 22:47343751-47343773 GAGGCCAAGCCAGGCTGCCCAGG + Intergenic
1184887321 22:47354357-47354379 GGGGCCACTCCAGTCTGCCAGGG - Intergenic
1185281952 22:49976017-49976039 GGGGCCACGACCTGCTGCCAGGG + Intergenic
1185302943 22:50092438-50092460 GAGGTTTCACCATGCTGCCCAGG - Intronic
949476752 3:4453858-4453880 GAGGTCTCACTATGTTGCCAAGG + Intronic
949589258 3:5476304-5476326 GAGGTCTCACCATGTTGCCCGGG + Intergenic
949842167 3:8331619-8331641 GTGGCCACACCCAGCTGCAAAGG + Intergenic
950071659 3:10157488-10157510 GAGGTCTCACTATGTTGCCAAGG - Intergenic
950756620 3:15178572-15178594 GAGGCCACTCCCTTCAGCCAAGG - Intergenic
951213801 3:20004913-20004935 GAGGCCTCACTATGTTGCCCAGG - Intronic
951479683 3:23146811-23146833 GAGGTCTCACCATGTTGCCCAGG + Intergenic
952177816 3:30885796-30885818 GAGATCTCACCATGCTGCCCAGG + Intronic
952741097 3:36735805-36735827 AAGGCCATACCATGCTGCCTGGG - Intronic
953333039 3:42070618-42070640 GAGGCCTCACTATGTTGCCCAGG + Intronic
953498065 3:43405663-43405685 GAGGTCTCACCATGTTGCCCAGG + Intronic
953600685 3:44360795-44360817 GAGGTTTCACCATGCTGCCCGGG + Intronic
954196421 3:48999660-48999682 GAGGCCCCAACATGCTGACTGGG + Intronic
954695937 3:52426147-52426169 GAGGTTTCACCATGTTGCCAAGG + Intergenic
954737010 3:52715077-52715099 GAGGCCCCACCTTCCGGCCAGGG + Intronic
955534544 3:59909223-59909245 GAGGCTTCACCATGCTGGCCAGG + Intronic
955638013 3:61051439-61051461 GAGGCTTCACCATGTTGCCCAGG + Intronic
955967589 3:64404877-64404899 GAGGCCACAGCATGCTAGCCAGG + Intronic
956882007 3:73520311-73520333 AAGGCCTCACCATGTTGCCCAGG - Intronic
956988214 3:74729480-74729502 GAGGTCTCACCATGTTGCCCAGG + Intergenic
957328920 3:78734367-78734389 GGGGTCTCACCATGTTGCCAAGG - Intronic
957342224 3:78915847-78915869 GAGGTCTCACTATGCTGCCCAGG + Intronic
957924461 3:86790658-86790680 GAGGTCTCACCATGTTGCCCAGG + Intergenic
958039377 3:88207757-88207779 GGGGTCACACCATGCTGGCCAGG + Intergenic
958653924 3:96977089-96977111 TAGGCCACTACATGCTGCCTAGG + Intronic
958843871 3:99241769-99241791 GAGGCCTCACTATGTTGCCCAGG - Intergenic
958937123 3:100267977-100267999 GAGGCCTCACTATGTTGCCCAGG - Intronic
959057549 3:101583131-101583153 GAGGCCTCACTATGTTGCCCAGG - Intronic
959708259 3:109359233-109359255 AAGGTCTCACCATGCTGCCCAGG + Intergenic
960191680 3:114714214-114714236 GAGGACACACCATGGTTTCATGG - Intronic
960604890 3:119495195-119495217 GAGGTCTCACCATGTTGCCCAGG - Intergenic
960979714 3:123211648-123211670 GAGGTCTCACCATGTTGCCTAGG + Intronic
961004478 3:123395684-123395706 GGGGTCACACTATGTTGCCAAGG - Intronic
961161709 3:124731989-124732011 GAGGTCTCACCATACTGCCCAGG + Intronic
961210025 3:125118430-125118452 GAGGTCTCACCATGTTGCCCAGG - Intronic
961471291 3:127114806-127114828 GAGCCCACACCATGCAGGCAGGG - Intergenic
961861974 3:129924547-129924569 GAGGTTTCACCATGCTGCCTGGG + Intergenic
962469301 3:135691185-135691207 TAGGCTACACCATGCAGCCTAGG - Intergenic
963093396 3:141508568-141508590 GAGATCTCACCATGTTGCCAAGG + Intronic
963809974 3:149766606-149766628 GAGGACTCACCATGTTGCCCAGG - Intronic
964121007 3:153183468-153183490 GAGGTCTCACTATGCTGCCCAGG - Intergenic
965261460 3:166490464-166490486 GAGGTTTCACCATGCTGCCCAGG + Intergenic
965573243 3:170192221-170192243 GGGGCTTCACCATGCTGCCCAGG + Intergenic
965695130 3:171400371-171400393 GAGGTCTCACTATGCTGCCTCGG - Intronic
966812010 3:183855325-183855347 GAGGTCTCACTATGCTGCCCAGG + Intronic
966845478 3:184126000-184126022 GAGGATTCACCATGCTGCCCAGG + Intergenic
966899443 3:184469693-184469715 GAGGCCACAGGATGCAGACAAGG - Intronic
968148020 3:196315894-196315916 GAGGCCTCACCATGTTGCCTAGG + Intronic
968219887 3:196928996-196929018 GAGGTCTCACCATGTTGCCCAGG - Intronic
968222832 3:196951102-196951124 GAGGCCACACCTAGCTGCAAAGG - Intronic
968320938 3:197767643-197767665 GAGGCCTCACTATGTTGCCCAGG + Intronic
968628138 4:1637307-1637329 GCTGCCACCCCACGCTGCCAGGG + Intronic
968793021 4:2681653-2681675 GAGGTCTCACCATGTTGCCCAGG + Intronic
968916167 4:3497894-3497916 GAGGCAACAGCAGGCTGCCCAGG - Intronic
968983138 4:3861423-3861445 GAGGCCCCAGCATGGTGCCTGGG + Intergenic
969390282 4:6887711-6887733 GAGGTTTCACCATGCTGCCCAGG + Intergenic
969608444 4:8213858-8213880 GAGGCCCCACTCTGCTGCCCAGG - Intronic
969737847 4:9002884-9002906 GAGGCTTCACCATGTTGCCCAGG - Intergenic
970560100 4:17274287-17274309 GAGGTCTCACCATGTTGCCTAGG - Intergenic
971032061 4:22649274-22649296 GAGGCCTCACCATGTTTCCCAGG + Intergenic
971218845 4:24686684-24686706 GGGGTCTCACCATGCTGCCCAGG - Intergenic
971334442 4:25709996-25710018 GAGGCTTCACCATGTTGCCCAGG + Intergenic
972198734 4:36686435-36686457 GAGGTCTCACGATGCTGCCCAGG + Intergenic
972482351 4:39509169-39509191 GGGGCTTCACCATGCTGCCCAGG + Intronic
972780237 4:42280790-42280812 GAGGTCTCACTATGCTGCCCAGG + Intergenic
973941090 4:55911312-55911334 GAGGTCTCACCATGTTGCCCAGG + Intergenic
974042894 4:56872826-56872848 ACGGCCTCACCATGTTGCCAAGG - Intergenic
974415141 4:61596659-61596681 GAGGTCTCACCATGTTGCCCAGG - Intronic
974651519 4:64759392-64759414 GAGGATACTCCATGCTGCCATGG - Intergenic
975588526 4:75976816-75976838 GTGCCCACACCATGCTCCCATGG + Intronic
975593016 4:76018834-76018856 GAGGCTTCACCATGTTGCCCAGG - Intronic
977933023 4:102768781-102768803 GAGGTCTCACCATGTTGCCCAGG - Intergenic
978770866 4:112455392-112455414 GAGGTTTCACCATGTTGCCAAGG - Intergenic
978791167 4:112664875-112664897 GAGGTCTCACCATGTTGCCCAGG - Intergenic
978954744 4:114599378-114599400 GAGGCCAGAGCCAGCTGCCAGGG + Intronic
979587279 4:122435844-122435866 GTGGTCACACCATGTTGCCTAGG - Intergenic
982738257 4:159029715-159029737 GATGCCACACTATGCTGTGATGG + Intronic
983519734 4:168695406-168695428 GGTGCCACACCACGCTGACAGGG + Intronic
983550699 4:169014479-169014501 GAGGTCTCACCATGTTGCCCAGG - Intergenic
983663124 4:170152224-170152246 GAGGTCTCACCATGTTGCCCAGG + Intergenic
984676290 4:182551827-182551849 GGGGTCTCACTATGCTGCCAAGG - Intronic
984681149 4:182610487-182610509 GGGGTCTCACCATGCTGCCCAGG - Intronic
984797956 4:183683128-183683150 GAGGTCTCACTATGCTGCCCAGG - Intronic
984874178 4:184352755-184352777 GAGGTCTCACTATGCTGCCCAGG - Intergenic
985315680 4:188656939-188656961 GAGGTCTCACTATGCTGCCAAGG + Intergenic
986054249 5:4120058-4120080 GGGGCCCCACTATGTTGCCAAGG + Intergenic
986114531 5:4759078-4759100 GAAGCCACACCCTGTTACCATGG + Intergenic
986219643 5:5756401-5756423 GAGGCCCCACTATGTTGCCCAGG + Intergenic
986377909 5:7151053-7151075 GAGGTCTCACTATGTTGCCAGGG + Intergenic
987141922 5:14955162-14955184 GAGGCCAGACCATGCAGTCCAGG - Intergenic
987148922 5:15019183-15019205 GGGGTCTCACCATGTTGCCAAGG + Intergenic
987565814 5:19584754-19584776 GGGGCCTCACCATGTTGCCCTGG - Intronic
987668915 5:20983234-20983256 GTGGCCCCACCATGCTGCCAGGG - Intergenic
987718802 5:21608706-21608728 GAGGCCTCACTATGTTGCCCAGG + Intergenic
987781858 5:22447947-22447969 GAGGCCTCATCATGTTGCCCAGG - Intronic
988137067 5:27187515-27187537 GAGGTCTCACCATGTTGCCCAGG - Intergenic
988488289 5:31685713-31685735 GAGGTTTCACCATGTTGCCAAGG + Intronic
988685494 5:33521596-33521618 GGGGTCTCACCATGTTGCCAAGG + Intergenic
989367293 5:40670874-40670896 GAGGTCTCACTATGTTGCCAAGG - Intergenic
990440088 5:55835531-55835553 GGGGTCTCACCATGCTGCCAGGG + Intergenic
990571195 5:57080723-57080745 GAGGTCTCACTATGCTGCCCTGG + Intergenic
990978168 5:61577107-61577129 GTGGCCAGACAATGCTGCAAAGG - Intergenic
991390687 5:66140468-66140490 GAGGTCTCACTATGCTGCCCAGG - Intronic
991573585 5:68080130-68080152 GAGGTCACACTATGTTGCCCAGG + Intergenic
991686606 5:69187937-69187959 GAGGTCTCACTATGCTGCCCAGG + Intergenic
992119946 5:73582578-73582600 GAGGTCTCACCATGTTGCCCAGG + Intronic
992325781 5:75658018-75658040 GAGGCCTCACTATGTTGCCCAGG - Intronic
993712290 5:91237672-91237694 GGGGCCTCACCATGTTGCCCAGG - Intergenic
995115442 5:108472959-108472981 GCACCCACACCATGCTCCCACGG - Intergenic
995223537 5:109677990-109678012 GAGGTCTCACCATGTTGCCCAGG + Intergenic
995599257 5:113777800-113777822 GAGGTCTCACTATGCTGCCCAGG - Intergenic
995679163 5:114697786-114697808 GAGGCCTCACTATGTTGCCCAGG + Intergenic
997538652 5:134642592-134642614 GAGGTCTCACCATGTTGCCCAGG - Intronic
997560074 5:134838751-134838773 GAGGTCATGCCATGTTGCCAAGG - Intronic
998049407 5:139019402-139019424 GGCGCCATACCATGCTGTCACGG + Intronic
998119245 5:139562052-139562074 GAGTCCACACCATGCGGGCCTGG - Intronic
998409231 5:141896580-141896602 GCGTCCACACCCAGCTGCCAGGG + Intergenic
998433300 5:142085105-142085127 GGGGCCTCACCATGTTGCCCAGG - Intergenic
998510195 5:142706754-142706776 GTGGCCACACAAAGCTGCCCAGG + Intergenic
998792470 5:145779987-145780009 GAGGTCTCACCATGTTGCCCAGG - Intronic
998928028 5:147148802-147148824 GTCCCCACACCTTGCTGCCAAGG - Intergenic
998970551 5:147586782-147586804 GAGGTCTCACCATGTTGCCCAGG + Intronic
999305821 5:150518966-150518988 GAGGTCTCACCATGTTGCCCAGG + Intronic
999421579 5:151448941-151448963 GAGGTCTCACTATGCTGCCCAGG + Intronic
999826866 5:155281983-155282005 GGGGCCACACCATTCATCCAAGG - Intergenic
1000247274 5:159459116-159459138 GAGGCCACCTCATGTTGGCATGG - Intergenic
1000247744 5:159462959-159462981 GAGGTCTCACCATGTTGCCCAGG + Intergenic
1001039493 5:168323352-168323374 GAGGTCTCACCATGTTGCCCAGG - Intronic
1001055071 5:168442409-168442431 AAGGCCTCACCATGTTGCCCAGG - Intronic
1001446763 5:171791210-171791232 GGGGCCACGTCATGGTGCCAGGG - Intronic
1002590169 5:180285730-180285752 GAAGCCTCACCATGTTGCCCAGG - Intronic
1003911545 6:10748097-10748119 GAGGCAACACTATGCTACAAGGG - Intronic
1004340048 6:14800063-14800085 ATGGCCACACCAAGCTGCAAGGG - Intergenic
1004488554 6:16091727-16091749 GGGGTCTCACCATGCTGCCCAGG - Intergenic
1004546706 6:16604776-16604798 GAGGCCTCACTATGTTGCCCAGG + Intronic
1004896248 6:20150771-20150793 GAGGTTTCACCATGCTGCCCAGG + Intronic
1005608497 6:27500103-27500125 GGGGTCTCACCATGCTGCCCAGG - Intergenic
1005970233 6:30755240-30755262 GAGGTCTCTCCATGCTGCCCAGG - Intergenic
1007459268 6:42005664-42005686 GGGGCCTCACCATGTTGCCGAGG - Intronic
1007579357 6:42947226-42947248 GAGGTCTCACTATGCTGCCCAGG - Intergenic
1008312619 6:49995058-49995080 AAGGCTACACAATGCTACCAGGG + Intergenic
1008384689 6:50875420-50875442 GAGGCCACAACATGCTCCCAGGG + Intergenic
1008572745 6:52830716-52830738 GAGGCCCCACCATGCTCAGAGGG + Intergenic
1008886775 6:56439875-56439897 GTGGCCACACCTAGCTGCAAGGG + Intergenic
1010190753 6:73194029-73194051 GAGGTCTCACCATGTTGCCCAGG + Intronic
1011088231 6:83567127-83567149 GGGGCCTCACTATGCTGCCCAGG + Intronic
1011419752 6:87158461-87158483 GGGGCCACGCCATGCTGCTCAGG - Intronic
1012405114 6:98887055-98887077 GAGTTCACACCATGTTGCCCAGG - Intronic
1012553539 6:100485998-100486020 GAGGCCACAGCAGGCTGAGATGG - Intergenic
1013083981 6:106840132-106840154 GGGGCCTCACCATGTTGCCCAGG + Intergenic
1013537878 6:111079932-111079954 GAGGTCTCACCATGTTGCCCAGG - Intergenic
1014436505 6:121426563-121426585 GGGGCCTCACTATGCTGCCCAGG + Intergenic
1015761623 6:136668186-136668208 GTGGCCACACTATGTTGCCCAGG - Intronic
1015991602 6:138950280-138950302 GAGATCTCACCATGTTGCCAGGG - Intronic
1016471237 6:144376485-144376507 GAGGCCTCACTATGTTGCCCAGG + Intronic
1016846542 6:148573486-148573508 GAGGTCACACCATGTTGTCCAGG - Intergenic
1016980501 6:149849563-149849585 GAGGTCTCACTATGCTGCCCAGG - Intronic
1017121810 6:151030987-151031009 GAGGTCTCACCATGTTGCCCAGG - Intronic
1017620505 6:156291901-156291923 GAGGCCTCACTATGTTGCCCGGG + Intergenic
1017783199 6:157732737-157732759 GAGGTCCCACTATGCTGCCCAGG + Intronic
1018215637 6:161524539-161524561 GGGGCCTCACTATGCTGCCCAGG + Intronic
1019135479 6:169905085-169905107 GAGACCACACCTGACTGCCAGGG + Intergenic
1019619615 7:1985191-1985213 GAGGCCTACCCATGCTGCCCGGG - Intronic
1019620628 7:1990211-1990233 GAGCCCTCACCTTGCAGCCAGGG - Intronic
1019699490 7:2467600-2467622 GAGGTCTCACCATGTTGCCCAGG + Intergenic
1019733742 7:2640596-2640618 CACACCACACCAGGCTGCCAAGG - Intronic
1019825990 7:3284842-3284864 GAGGTCTCACCATGTTGCCCAGG - Intergenic
1019880634 7:3857489-3857511 GGGGTCTCACCATGTTGCCAAGG - Intronic
1020040872 7:4999887-4999909 GAGGTCTCACTATGTTGCCAGGG - Intronic
1020924527 7:14309022-14309044 GAGGCCTTACCATGTTGCCGAGG - Intronic
1021678368 7:23104729-23104751 GAGGTCACACTATGTTGCCCAGG - Intergenic
1022012904 7:26324550-26324572 GAGGCCTCACTATGTTGCCCAGG + Intronic
1022018591 7:26376766-26376788 GGGGCTACACCGTGCTGCCCCGG + Intergenic
1022337501 7:29435488-29435510 TAGGCCACACCATACAGCCAAGG - Intronic
1022755144 7:33279265-33279287 GAGGACTCACCATGTTGCCCAGG + Intronic
1023041288 7:36175421-36175443 GAGGTCTCACCATGTTGCCCTGG + Intronic
1023390711 7:39709087-39709109 GAGGTCTCACCATGTTGCCCAGG - Intergenic
1023399182 7:39779436-39779458 GGGGCCGCACTATGTTGCCATGG + Intergenic
1023484228 7:40666934-40666956 GAGGTCTCACTATGTTGCCAAGG - Intronic
1023856273 7:44186034-44186056 GATGCCCCCCCATACTGCCATGG - Intronic
1023953516 7:44867133-44867155 GAGGTCTCACCATGTTGCCCAGG + Intergenic
1023985691 7:45093691-45093713 GAGGTCTCACCATGTTGCCCAGG + Intergenic
1024032529 7:45475591-45475613 GAGAACACCCAATGCTGCCAAGG + Intergenic
1024551189 7:50563791-50563813 GAGGTCTCACCATGTTGCCCAGG + Intronic
1024651259 7:51405269-51405291 GGGGCCGCACTATGTTGCCATGG - Intergenic
1024675832 7:51637260-51637282 GATGACTGACCATGCTGCCAGGG - Intergenic
1024959934 7:54963408-54963430 GAGGCAACACATTTCTGCCAAGG + Intergenic
1025055393 7:55760850-55760872 GGGGCCGCACTATGTTGCCATGG - Intergenic
1025081737 7:55989431-55989453 GAGGTTTCACCATGTTGCCAAGG - Intronic
1025133465 7:56391079-56391101 GGGGCCACAGTATGTTGCCATGG - Intergenic
1025234191 7:57222880-57222902 GTGGCCACTCCTTGCTGCAAAGG + Intergenic
1026016906 7:66678696-66678718 GAGGTCTCACCATGTTGCCCGGG + Intronic
1026154234 7:67813284-67813306 GAGGTCTCACCATGTTGCCCAGG + Intergenic
1026309642 7:69172554-69172576 CAGGCCACCCAGTGCTGCCAAGG + Intergenic
1026357573 7:69572481-69572503 GAGGCCTCACTATGTTGCCCAGG - Intergenic
1026655421 7:72252406-72252428 GAGGTCTCACCATGTTGCCCAGG - Intronic
1026804018 7:73418351-73418373 GAGGCTCCACCAGGCAGCCAGGG + Intergenic
1027874960 7:83756958-83756980 GAGGTCTCACTATGCTGCCCAGG + Intergenic
1028068393 7:86417479-86417501 GAGGTTTCACCATGTTGCCAAGG + Intergenic
1028475191 7:91245649-91245671 GGGGCCTCACCATGTTGCCCAGG - Intergenic
1028843886 7:95458742-95458764 GAGGTCTCACTATGTTGCCAAGG + Intergenic
1029007462 7:97225648-97225670 GAGGCCTCACCTTGCTGCCCAGG - Intergenic
1029074771 7:97927109-97927131 GAGGCTTCACCATGTTGCCCAGG + Intergenic
1029132115 7:98339555-98339577 CCGGGCACACCATGGTGCCACGG - Intronic
1029186948 7:98746244-98746266 GAGGCCTCACTATGTTGCCCAGG + Intergenic
1029251101 7:99237002-99237024 GAGGTCTCACCATGTTGCCAAGG - Intergenic
1029555749 7:101267869-101267891 GAGGTCTCACCATGTTGCCCAGG + Intergenic
1029691792 7:102187301-102187323 GAGGTCACACTATGTTGCCCAGG - Intronic
1030128766 7:106179287-106179309 GAGGTCCCACTATGTTGCCAGGG + Intergenic
1030895259 7:115051977-115051999 AAGGTCTCACCATGTTGCCAGGG - Intergenic
1031551919 7:123124971-123124993 GGGGTCTCACCATGCTGCCAAGG + Intronic
1032235918 7:130122735-130122757 GAGGCCGCACCGTGTTGCCCAGG + Intronic
1032270695 7:130402150-130402172 GAGGCCTCACCATGTTGCCCGGG - Intronic
1032756928 7:134899836-134899858 GAGGTCTCACTATGCTGCCCAGG + Intronic
1033135511 7:138780710-138780732 GAGGCCTCACTATGTTGCCCAGG - Intronic
1034673930 7:152878082-152878104 GAGGTCTCACCATGTTGCCCAGG - Intergenic
1035491544 7:159283970-159283992 GAGGTCTCACCATGTTGCCCAGG + Intergenic
1036185826 8:6621827-6621849 GTGACCACACGACGCTGCCAGGG - Intronic
1036257858 8:7219883-7219905 GAGGCTTCACCATGTTGCCCAGG + Intergenic
1036259107 8:7226881-7226903 GAGGCTTCACCATGTTGCCCAGG + Intergenic
1036309906 8:7678479-7678501 GAGGCTTCACCATGTTGCCCAGG + Intergenic
1036311160 8:7685476-7685498 GAGGCTTCACCATGTTGCCCAGG + Intergenic
1036358365 8:8060624-8060646 GAGGCTTCACCATGTTGCCCAGG - Intergenic
1036359629 8:8067622-8067644 GAGGCTTCACCATGTTGCCCAGG - Intergenic
1036421726 8:8602373-8602395 GAGGTCTCACCATGTTGCCCAGG - Intergenic
1036891329 8:12599329-12599351 GAGGCTTCACCATGTTGCCCAGG + Intergenic
1036892585 8:12606319-12606341 GAGGCTTCACCATGTTGCCCAGG + Intergenic
1036898882 8:12657293-12657315 GAGGCTTCACCATGTTGCCCTGG + Intergenic
1036945505 8:13090997-13091019 GAGGTCTCACCATGTTGCCCGGG + Intronic
1037723575 8:21465335-21465357 GAGGTTTTACCATGCTGCCAAGG - Intergenic
1037868377 8:22466935-22466957 GGGGTCTCACCATGCTGCCCAGG + Intronic
1038618325 8:29116274-29116296 GGGGTCTCGCCATGCTGCCAGGG - Intronic
1038649301 8:29387933-29387955 GAGGTTACACCATGTTGCCCAGG + Intergenic
1038810852 8:30841109-30841131 GAGGTCTCACCATGTTGCCCAGG + Intronic
1039080968 8:33733608-33733630 GAGGTCTCACCATGCTGCCCAGG + Intergenic
1039846075 8:41326495-41326517 GAGGTCTCACCATGTTGCCCAGG + Intergenic
1039992773 8:42504130-42504152 GAGGTCTCACCATGTTGCCCAGG + Intronic
1040279999 8:46035563-46035585 GAGGTTTCACCATGTTGCCAAGG - Intergenic
1040674894 8:49736825-49736847 GAGGCAAGACCATGCTGCACAGG - Intergenic
1041238095 8:55825111-55825133 GAGGTCCCACCATGTTGCCCAGG + Exonic
1042147547 8:65746122-65746144 AAGGTCTCACCATGCTGCCCAGG + Intronic
1042368720 8:67966568-67966590 GAGGTCTCACCATGTTGCCCAGG - Intronic
1042834051 8:73061927-73061949 GAGGCCTCGCCATGTTGCCCAGG + Intergenic
1042907690 8:73789277-73789299 GAGGTCTCACCATGTTGCCCAGG - Intronic
1043846131 8:85166091-85166113 GAGGTCTCACCATGTTGCCCAGG + Intergenic
1044464120 8:92483909-92483931 GAGGCCACACCTAGGTGCAAAGG - Intergenic
1044674590 8:94716741-94716763 GGGGCTTCACCATGTTGCCAAGG + Intergenic
1045223313 8:100220012-100220034 GAGGCCAGGACATGCTGCCAGGG + Intronic
1045295882 8:100871467-100871489 GGGGTCTCACCATGCTGCCCAGG - Intergenic
1045361785 8:101439653-101439675 GAGTCCTCACTATGCTGCCCAGG - Intergenic
1047048325 8:121080005-121080027 GAGTCCACACCCTGCTACAATGG + Intergenic
1047724816 8:127674848-127674870 GAGGTCTCACTATGTTGCCAGGG - Intergenic
1047965990 8:130047254-130047276 GAGGTCTCACCATGTTGCCTAGG + Intergenic
1048035694 8:130675286-130675308 GAGGCCTCACTATGTTGCCCAGG + Intergenic
1048425110 8:134316189-134316211 GAGGCCATATCTTCCTGCCATGG + Intergenic
1048741529 8:137566174-137566196 GAGGTTTCACCATGTTGCCAAGG + Intergenic
1048922879 8:139246776-139246798 GAGGACAGACAGTGCTGCCAGGG - Intergenic
1049531359 8:143157153-143157175 GAGGCCACTCCCTGTGGCCAGGG - Intergenic
1049953217 9:665986-666008 GAGGTCACACTATGCTGCCCAGG - Intronic
1049991748 9:997975-997997 GAGGTCTCACCATGTTGCCTAGG - Intergenic
1051578176 9:18641123-18641145 GAGGGCACAGCATCCTGCAAAGG - Intronic
1051877645 9:21808391-21808413 GAGGTTTCACCATGCTGCCCAGG - Intronic
1053112894 9:35478002-35478024 AAGGCCACACCAAGCTTTCAAGG - Intergenic
1053326946 9:37161943-37161965 GAGGTCTCACCATGTTGCCTAGG - Intronic
1053374025 9:37589711-37589733 GAGGTATCACCATGTTGCCAAGG + Intronic
1054992681 9:71347716-71347738 GAGGCCTCACTATGTTGCCCAGG - Intronic
1056387629 9:86112156-86112178 GAGGAGACACCATGCTGTAAGGG + Intergenic
1056790145 9:89620008-89620030 GAGGCCAGGCCAGTCTGCCAGGG + Intergenic
1057496597 9:95565927-95565949 GAGGTCTCACTATGCTGCCCTGG + Intergenic
1057710311 9:97435436-97435458 GAGGTCTCACCATGTTGCCCAGG - Intronic
1058006344 9:99919293-99919315 GAGGTCTCACCATGCTGCCCAGG + Intronic
1058014855 9:100019350-100019372 GAGGTCTCACCATGTTGCCCAGG - Intronic
1058676240 9:107402688-107402710 GAGGTCTCACCATGTTGCCTAGG - Intergenic
1058789656 9:108430042-108430064 GGGGCCTCACCATGTTGCCCAGG - Intergenic
1059201398 9:112420482-112420504 GAGGCCTCACTATGTTGCCCAGG - Intronic
1060197119 9:121631037-121631059 GGGGCTACCCCATGCTGACAGGG + Intronic
1060540298 9:124424762-124424784 GAGGTCTCACCATGTTGCCCAGG - Intergenic
1060597929 9:124859196-124859218 GAGGCCTCACTATGTTGCCCAGG + Intronic
1060651873 9:125334706-125334728 GAGGTCTCACCATGTTGCCCAGG - Intronic
1061141106 9:128767435-128767457 GAGGGCTCACCATGTTGCCCAGG + Intronic
1062140518 9:134955362-134955384 GGGACCCCACCATGCAGCCATGG + Intergenic
1062263346 9:135674638-135674660 GAGGTCTCACCATGTTGCCCAGG - Intergenic
1062316035 9:135967376-135967398 GAGGCCACCCCAGCCTGCCCTGG + Intergenic
1062383361 9:136298333-136298355 GGGTCCACTCCATGGTGCCAAGG - Intronic
1062401365 9:136374122-136374144 GAGGCCACAGCAGCCTGCCAGGG + Intergenic
1062687846 9:137825076-137825098 GAGGCCTCATCCTGCAGCCAAGG - Intronic
1203520892 Un_GL000213v1:43893-43915 GTGGCCACACCCTGCAGTCAGGG - Intergenic
1185467126 X:361780-361802 GAGGCCACACCATGCTGCCATGG + Intronic
1185784973 X:2883048-2883070 GGGGCCTCACCATGTTGCCCAGG - Intergenic
1185955037 X:4479742-4479764 GAGGTCTCACTATGCTGCCCAGG - Intergenic
1186224859 X:7387800-7387822 GAGGTCTCACCATGTTGCCCAGG - Intergenic
1186228208 X:7424181-7424203 GAGGTCCCACCATGTTGCCCAGG - Intergenic
1186317748 X:8388870-8388892 GAGGTCACACCATGTTGCCCAGG - Intergenic
1186397690 X:9226263-9226285 GAGGTCTCACCATGTTGCCCAGG + Intergenic
1186439891 X:9576805-9576827 GGGGCCTCACCATGTTGCCCAGG - Intronic
1186650363 X:11553432-11553454 GAGGTCTCACCATGTTGCCCAGG + Intronic
1186970213 X:14833766-14833788 GAGGTTTCACCATGCTGCCCAGG - Intergenic
1187381202 X:18803646-18803668 GAGGTCTCACCATGTTGCCCAGG + Intronic
1187393751 X:18902884-18902906 GAGGTCTCACCATGCTGCCCAGG - Intronic
1187541506 X:20200872-20200894 GAGGTCTCACTATGCTGCCCAGG + Intronic
1190085912 X:47395106-47395128 GAGGCATCACCATGTTGCCCAGG + Intronic
1190363303 X:49668788-49668810 GAGGCTTCACCATGCTGGCCAGG + Intergenic
1190409602 X:50122991-50123013 GAGGTTTCACCATGCTGCCCAGG + Intergenic
1190414366 X:50166837-50166859 GAGGCCACACTTTGCTGCACTGG + Intergenic
1190770484 X:53509933-53509955 AAGGTCTCACTATGCTGCCAAGG - Intergenic
1191884112 X:65872193-65872215 CAGGCCTCACCTTGCTCCCAAGG + Intergenic
1192115348 X:68405380-68405402 GAGGTCTCACTATGCTGCCCAGG + Intronic
1192183983 X:68934007-68934029 GAGGTCTCACCATGTTGCCCAGG - Intergenic
1192299729 X:69887120-69887142 GAGGTCTCCCCATGCTGCCTAGG - Intronic
1192422528 X:71046197-71046219 GAGGTCTCACTATGCTGCCCAGG - Intergenic
1192427305 X:71088725-71088747 GAGGTCTCACCATGTTGCCCAGG + Intergenic
1192581646 X:72287868-72287890 GAGGTTTCACCATGTTGCCAAGG - Intronic
1192582056 X:72291717-72291739 GAGGTCTCACCATGTTGCCCAGG + Intronic
1192592940 X:72376098-72376120 GAGGTCTCACCATGTTGCCCAGG + Intronic
1193073589 X:77332572-77332594 AAGGCCACTCCATTGTGCCATGG + Intergenic
1194063467 X:89233771-89233793 GAGGCCAGATCATGGGGCCAAGG - Intergenic
1195352157 X:104005968-104005990 GAACCCACAGCATGCTGGCATGG - Intergenic
1195802024 X:108723379-108723401 GAGGTCTCACTATGCTGCCCAGG + Intronic
1196169348 X:112570452-112570474 GAGGTCTCACTATGCTGCCTAGG + Intergenic
1196681256 X:118472255-118472277 GGGGCCTCACCATGTTGCCTAGG + Intergenic
1196834025 X:119798403-119798425 GAGGTCTCACCATGTTGCCCAGG - Intergenic
1196903001 X:120404159-120404181 GAGGGCTCACCATGTTGCCCAGG - Intergenic
1196907917 X:120456224-120456246 GAGGTCTCACCATGTTGCCCGGG + Intronic
1197225064 X:123948804-123948826 GAGGTCTCACCATGTTGCCCAGG + Intergenic
1198128109 X:133667657-133667679 GAGGCTTCACCATGTTGCCCAGG - Intronic
1198407938 X:136333707-136333729 GAGGTCTCACCATGCTGGCCAGG + Intronic
1200717641 Y:6567874-6567896 GAGGCCAGATCATGGGGCCAAGG - Intergenic
1201311109 Y:12598735-12598757 GAGGCTATAGCATGCTGCAATGG + Intergenic
1201766183 Y:17575530-17575552 GAGGTTTCACCATGTTGCCAAGG - Intergenic
1201835369 Y:18330459-18330481 GAGGTTTCACCATGTTGCCAAGG + Intergenic