ID: 1185470169

View in Genome Browser
Species Human (GRCh38)
Location X:377193-377215
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 9, 1: 8, 2: 14, 3: 23, 4: 223}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185470169_1185470178 6 Left 1185470169 X:377193-377215 CCACACCCAGTGGGGCCACCATG 0: 9
1: 8
2: 14
3: 23
4: 223
Right 1185470178 X:377222-377244 TCTATACACTACTGTATGCAGGG 0: 12
1: 1
2: 15
3: 6
4: 135
1185470169_1185470181 24 Left 1185470169 X:377193-377215 CCACACCCAGTGGGGCCACCATG 0: 9
1: 8
2: 14
3: 23
4: 223
Right 1185470181 X:377240-377262 CAGGGACGGGCCGTCCACAGTGG 0: 7
1: 2
2: 0
3: 16
4: 158
1185470169_1185470182 25 Left 1185470169 X:377193-377215 CCACACCCAGTGGGGCCACCATG 0: 9
1: 8
2: 14
3: 23
4: 223
Right 1185470182 X:377241-377263 AGGGACGGGCCGTCCACAGTGGG 0: 7
1: 2
2: 0
3: 4
4: 71
1185470169_1185470180 11 Left 1185470169 X:377193-377215 CCACACCCAGTGGGGCCACCATG 0: 9
1: 8
2: 14
3: 23
4: 223
Right 1185470180 X:377227-377249 ACACTACTGTATGCAGGGACGGG 0: 12
1: 1
2: 14
3: 8
4: 97
1185470169_1185470183 26 Left 1185470169 X:377193-377215 CCACACCCAGTGGGGCCACCATG 0: 9
1: 8
2: 14
3: 23
4: 223
Right 1185470183 X:377242-377264 GGGACGGGCCGTCCACAGTGGGG 0: 7
1: 2
2: 0
3: 5
4: 90
1185470169_1185470177 5 Left 1185470169 X:377193-377215 CCACACCCAGTGGGGCCACCATG 0: 9
1: 8
2: 14
3: 23
4: 223
Right 1185470177 X:377221-377243 GTCTATACACTACTGTATGCAGG 0: 12
1: 1
2: 14
3: 3
4: 46
1185470169_1185470179 10 Left 1185470169 X:377193-377215 CCACACCCAGTGGGGCCACCATG 0: 9
1: 8
2: 14
3: 23
4: 223
Right 1185470179 X:377226-377248 TACACTACTGTATGCAGGGACGG 0: 12
1: 1
2: 16
3: 7
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185470169 Original CRISPR CATGGTGGCCCCACTGGGTG TGG (reversed) Intronic
900302830 1:1986490-1986512 CCTGGTGCCCCCAGAGGGTGAGG + Intronic
900780727 1:4615692-4615714 AACGCTGGCCCCACTGGCTGGGG + Intergenic
900977910 1:6028586-6028608 GCTGGTGGCCGCTCTGGGTGCGG + Intronic
901314395 1:8296084-8296106 CATGGTGGCCCCACAGGCTGAGG + Intergenic
901620093 1:10577950-10577972 AAAGGTGGCTCCCCTGGGTGGGG - Intronic
902450043 1:16491110-16491132 GATGGTGACCCCCATGGGTGGGG + Intergenic
903329211 1:22588609-22588631 CATGGTGGTCCTGATGGGTGGGG + Intronic
905740357 1:40364959-40364981 CATGGTGGCCAAAGTGGATGAGG + Intronic
907826059 1:58017822-58017844 CATGGTAGCCCCTCTAGGTGGGG + Intronic
908252507 1:62276072-62276094 CATGATGGCCCCCCAGGGTATGG - Intronic
908634874 1:66152410-66152432 CAGGGTGGCAGCACTGGCTGTGG + Intronic
915701555 1:157801794-157801816 CATGGTGGGGCCTCTGTGTGAGG - Intronic
917570736 1:176262925-176262947 CATGGTGTCTTCACTGGTTGAGG + Intergenic
919819081 1:201461675-201461697 CATGGTGGACCCACTGAGGCAGG + Intergenic
921624625 1:217364727-217364749 CATGGTTGCCCCTCTGACTGAGG - Intergenic
1064370922 10:14751034-14751056 CATGGTGGCACATCTGGGAGGGG + Intronic
1064655055 10:17548409-17548431 CATGGTGGGCCTACAGGGAGGGG + Intergenic
1067023876 10:42826921-42826943 CAGCGTGGCCCCGCAGGGTGGGG + Intronic
1067064793 10:43097575-43097597 CATAGTGGCCTCACAGGGCGAGG - Intronic
1067306665 10:45071041-45071063 CATTGTGGCCCCACTGCCTGGGG - Intergenic
1067370422 10:45677323-45677345 CATGGTGGCCGCACAGAGAGTGG - Intergenic
1067389366 10:45848872-45848894 CATGGTGGCCGCACAGAGAGTGG + Intronic
1067444886 10:46335672-46335694 CATGGTGGCCGCACAGAGAGTGG - Intergenic
1067502104 10:46814968-46814990 CATGGTGGCCGCACAGAGAGTGG - Intergenic
1067592483 10:47525052-47525074 CATGGTGGCCGCACAGAGAGTGG + Intronic
1067639599 10:48033125-48033147 CATGGTGGCCGCACAGAGAGTGG + Intergenic
1067701476 10:48576152-48576174 TATGGGCTCCCCACTGGGTGTGG + Intronic
1067784004 10:49229473-49229495 CATGGTGGCCCACCTGGGCTGGG + Intergenic
1067873897 10:49987183-49987205 CATGGTGGCCGCACAGAGAGTGG - Intronic
1070136577 10:73699237-73699259 CATGGTGGCCGCACAGAGAGTGG + Intergenic
1071514928 10:86291108-86291130 CATGGTGGCCACACTCTCTGGGG - Intronic
1071575896 10:86726088-86726110 CCCGCTGCCCCCACTGGGTGCGG + Intronic
1076449847 10:130549401-130549423 CAAGGGAGCCCCACTGTGTGAGG + Intergenic
1076618977 10:131775018-131775040 CAGGGAGGCCCCACAGAGTGTGG - Intergenic
1076798976 10:132811968-132811990 GCTGATGGCCCCACTGTGTGGGG - Intronic
1077037466 11:502389-502411 CATGGTGGCCTTTCTGGGGGTGG - Exonic
1077283009 11:1754044-1754066 CATGGTGGGCCCGGTGGATGAGG - Exonic
1077295823 11:1825810-1825832 CGTGCAGGCCCCACTGTGTGCGG - Intergenic
1077327507 11:1970073-1970095 CCTGGCGGCCTCACTGGGGGAGG - Intronic
1078728802 11:13957269-13957291 CATGGTGTCCAGGCTGGGTGGGG + Intergenic
1080531679 11:33182379-33182401 CTGTGTGGCCCCACTGGGAGAGG - Intergenic
1080577085 11:33609697-33609719 CCTGCCGGCCCCACTGGGTCAGG + Intronic
1084288215 11:68145580-68145602 CCTGGCTGCCCCACTGGGGGTGG + Intergenic
1084545372 11:69812665-69812687 CATGGTGTACCCAGTGTGTGGGG - Intronic
1085309637 11:75508682-75508704 CATGGGGGCCACAGTGGGGGAGG - Intronic
1088618062 11:111653153-111653175 CAGGGTGGCCCTTCTGGTTGAGG - Intronic
1088728137 11:112657434-112657456 CTTGTGGGCCCCCCTGGGTGTGG - Intergenic
1089290579 11:117435701-117435723 CATCCTGGCCACACTGGGGGTGG - Exonic
1089607900 11:119652226-119652248 CATGGTGACCACACCGGGTGGGG - Intronic
1090807626 11:130212226-130212248 ACTGGTGGGCCCGCTGGGTGGGG + Intergenic
1090846110 11:130531293-130531315 CAGGATGGCCTCTCTGGGTGAGG - Intergenic
1090869565 11:130731229-130731251 GATTGGGGCCCCGCTGGGTGTGG + Intergenic
1091250635 11:134141271-134141293 CAAAGTGGCCTCTCTGGGTGCGG + Intronic
1094458652 12:30668728-30668750 TATGGGGGCCCTACTGTGTGTGG - Intronic
1094721052 12:33063934-33063956 CATGGTGGTCAGACTGGGTTGGG - Intergenic
1096584179 12:52608843-52608865 AATGCTGGCCCCACAGGGTTTGG - Intronic
1097262315 12:57726639-57726661 CGTGGTGGCCGCGCTGGGCGTGG + Exonic
1102646416 12:114406698-114406720 TCTGGTGGCCCCACTGGGTGGGG - Intronic
1103620866 12:122186367-122186389 CATGCTGGCCACACTATGTGGGG - Intronic
1104104155 12:125643182-125643204 TGTGGTGGCCCCACTGGTTGAGG + Intronic
1104760260 12:131293906-131293928 CATTGTGGCTCCACAGGGAGAGG + Intergenic
1104819508 12:131666740-131666762 CATTGTGGCTCCACAGGGAGAGG - Intergenic
1106588367 13:31076722-31076744 GATGGTTGCCTCACTGAGTGAGG + Intergenic
1107435260 13:40376020-40376042 CATGATGGCCCCACTGGGAAGGG + Intergenic
1108957801 13:56182817-56182839 CAGGGAGGCCCCACTCAGTGAGG - Intergenic
1113892484 13:113743725-113743747 CGTGGTGGCCGGAGTGGGTGGGG - Intergenic
1116706204 14:48304793-48304815 CATGATGGGACCACTGAGTGGGG + Intergenic
1119708843 14:76806631-76806653 CTCGGTGGCCCCGCTGTGTGTGG - Exonic
1122325634 14:100879473-100879495 CCTGGTGGCCTCAGTGGGGGTGG + Intergenic
1122689995 14:103527770-103527792 CGTGGTGGCCCCACAGGGACAGG + Intergenic
1126375172 15:47990392-47990414 TCTGGTGGCACTACTGGGTGTGG - Intergenic
1127337319 15:58001203-58001225 CAAAGTGGCACCACTGGTTGAGG + Intronic
1128101230 15:65001739-65001761 CGTGGTGGCCCCACTTTGGGAGG + Exonic
1128450806 15:67804982-67805004 CATGGAGGCCAGGCTGGGTGTGG - Intronic
1128505939 15:68272788-68272810 CATAGGAGCCACACTGGGTGTGG - Intergenic
1129473664 15:75768783-75768805 CATCTTGGCCCCAGTGGGTTGGG - Intergenic
1132243654 15:100278762-100278784 AATCCTGGGCCCACTGGGTGTGG - Intronic
1132496274 16:264932-264954 CAGGGTGGTCCGCCTGGGTGAGG + Exonic
1132846698 16:2004029-2004051 CAGGGTGGAGCCACCGGGTGAGG - Intronic
1132972871 16:2697470-2697492 CATGGCCACGCCACTGGGTGGGG - Intronic
1133030827 16:3010218-3010240 CCTGGTGGCCCCACAGAGTCTGG - Intergenic
1133689778 16:8202172-8202194 CAGGGTAAGCCCACTGGGTGTGG - Intergenic
1134494840 16:14724704-14724726 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134500223 16:14763824-14763846 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134526765 16:14950436-14950458 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134545641 16:15105912-15105934 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134580356 16:15365226-15365248 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134714342 16:16348913-16348935 GATGGGGGCCCCACTGGGTGGGG - Intergenic
1134722217 16:16392277-16392299 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134945210 16:18319592-18319614 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134952474 16:18359745-18359767 GATGGGGGCCCCACTGGGTGGGG + Intergenic
1135887582 16:26325375-26325397 CATGGTGGCTCCACTTTGAGAGG + Intergenic
1137406615 16:48194090-48194112 CAAGGTGTCCACATTGGGTGGGG - Intronic
1137568323 16:49548151-49548173 CTTGGAGGACCCACTGGGTGAGG - Intronic
1139942205 16:70613385-70613407 CATGGCGGCCACACTGGATGGGG + Intronic
1140832541 16:78765151-78765173 CACAGTGGCCCCACAGTGTGGGG + Intronic
1141521912 16:84586100-84586122 TATGGTGGTCCCTCTGGGTCAGG - Intronic
1141545091 16:84761521-84761543 CCTTGTGGCCCCACTGGGAGAGG - Intronic
1143527711 17:7482104-7482126 GCTGGTGGCCCTGCTGGGTGGGG + Exonic
1144275892 17:13667829-13667851 CATGGTGGCTCCACTGCCAGGGG - Intergenic
1144803657 17:17949392-17949414 CAAGGAGGCCCAACTGGGTCAGG + Intronic
1146408139 17:32557424-32557446 AAAGGTGGCCAAACTGGGTGGGG + Intronic
1146731047 17:35194166-35194188 GCTGGTGGCCCTGCTGGGTGGGG - Exonic
1149576181 17:57715286-57715308 CCTGGTGGCCCCTCTCTGTGTGG - Intergenic
1152644669 17:81463245-81463267 CAGGGAGGGCCCACGGGGTGGGG - Intronic
1154115454 18:11609715-11609737 GCTGGTGGCCCTGCTGGGTGGGG + Intergenic
1154502052 18:15001957-15001979 CGTGCAGCCCCCACTGGGTGCGG - Intergenic
1155429848 18:25743857-25743879 CAGGGAGGCCCCACCTGGTGAGG - Intergenic
1160388393 18:78512055-78512077 CATGGCGGCCCCACTGCCAGTGG - Intergenic
1160942386 19:1626554-1626576 CGCGGTGGCCACACAGGGTGCGG - Intronic
1161166280 19:2789547-2789569 CTTGTTCCCCCCACTGGGTGTGG + Intronic
1161796985 19:6392974-6392996 CATGGCGGCCCTAGTGAGTGTGG - Exonic
1162301443 19:9847344-9847366 CAGGGTGGCCCCACCCTGTGTGG - Intronic
1163268697 19:16236208-16236230 CATGGGGGCTCCACAGGGTGGGG - Intronic
1163533309 19:17863102-17863124 CTTGGTGGCCCCACAGGATGGGG + Intronic
1164599761 19:29552891-29552913 CAGGGAGGCCCCACCAGGTGAGG - Intronic
1164610257 19:29626938-29626960 CACTGTGTCCCCACTGGGTGTGG + Intergenic
1165152058 19:33766726-33766748 CAGGCTGGCCCGACTGGGGGTGG - Intronic
1165418623 19:35711198-35711220 CATGGTCACCCCTCTGAGTGTGG - Intronic
925555739 2:5130000-5130022 CATGGCGAGGCCACTGGGTGTGG + Intergenic
926421441 2:12703747-12703769 AATAGTGGCCCCACAGGGTGGGG - Intergenic
927546603 2:23959704-23959726 CTGGGTGACTCCACTGGGTGAGG - Intronic
927875649 2:26653625-26653647 GATGGTGGCCCCCTGGGGTGTGG - Intergenic
928825841 2:35420077-35420099 AATGATGGCCCTACTGGGTTTGG + Intergenic
929615225 2:43301476-43301498 CATGGAGCTCCAACTGGGTGGGG + Intronic
932432957 2:71686405-71686427 CATGGTGATCCCACTGGGGCAGG - Intronic
936006182 2:108891452-108891474 CATGATTTCCCCACTGGGTTAGG + Intergenic
938189386 2:129261973-129261995 CAAGGTGGCTCCACTGGAAGTGG + Intergenic
938501230 2:131832129-131832151 CATGCAGCCCCCACTGGGTGTGG - Intergenic
939933362 2:148258816-148258838 CATGGGGGCCCCCCTGTGGGTGG + Intronic
940410747 2:153360646-153360668 CAGGGAGGCCCCACCTGGTGAGG - Intergenic
944601652 2:201309404-201309426 CATGGAGGACCCACTCAGTGAGG - Intronic
946158163 2:217820478-217820500 CATGGTGCCCCCACTTGCAGGGG + Intronic
948319287 2:237056651-237056673 CTTGCTGGCCCCTCTGGGTAGGG - Intergenic
1170769924 20:19323633-19323655 CCTGGTGAACCCACTGGATGTGG - Intronic
1172126160 20:32626544-32626566 CATGGTGGCAACACTGGACGGGG + Intergenic
1173354047 20:42270333-42270355 CCTGGAGGACCCACTGAGTGTGG + Intronic
1174294981 20:49539539-49539561 CATGGGGGCCCCAGTGGGTGGGG - Intronic
1174353841 20:49985672-49985694 AATGGTGGGCCCAGTGGGTGGGG + Intronic
1175591932 20:60200313-60200335 CAGGGAGGCCCTATTGGGTGAGG + Intergenic
1175755573 20:61527719-61527741 CCTGGTGTCCCCAGTGAGTGAGG + Intronic
1176269212 20:64226915-64226937 CATGGTGGCCACGCTTTGTGAGG + Intronic
1178719430 21:34995169-34995191 CATAGTGGCCTCACAAGGTGGGG - Intronic
1179938456 21:44621520-44621542 CATGATGGCCCTACTGGGGAGGG - Intronic
1180022416 21:45136702-45136724 CAGGGTGCCTCCTCTGGGTGCGG - Intronic
1181313577 22:21958302-21958324 GAGGGTGGCACCACTGGCTGAGG + Intronic
1181346685 22:22224374-22224396 GAGGGTGGCACCACTGGCTGAGG + Intergenic
1182618325 22:31603688-31603710 GAGGGTGCCCTCACTGGGTGGGG + Intronic
950433898 3:12967449-12967471 CATGGCGGCCGCAGTGGGAGCGG + Exonic
951580737 3:24160108-24160130 CAAGGTGGCCCACCAGGGTGTGG + Intronic
952419206 3:33116248-33116270 CATGGTGGCCCCAAAAGGTTAGG + Intronic
952491323 3:33876455-33876477 CATGGGGGCCCCTCTGGGCCTGG + Intergenic
953376546 3:42433042-42433064 CTTGCTGGCCCACCTGGGTGTGG + Intergenic
953904071 3:46859469-46859491 CGTGCTGGCCACGCTGGGTGAGG - Exonic
954332155 3:49896842-49896864 CACCGTGGCCCCAGGGGGTGTGG + Exonic
954374011 3:50184842-50184864 CACGCTGGGCCCACCGGGTGCGG + Intronic
954447446 3:50554243-50554265 CATGATTGCCTCACTGTGTGGGG - Intergenic
955707399 3:61742658-61742680 CATGGTGGCCAAAGTGGGTGAGG - Intronic
961053923 3:123770495-123770517 CATGGTGTCCACACAGGGAGTGG + Intronic
961380862 3:126495852-126495874 CATGGTGGCCACACTGGGAGGGG - Intronic
961450038 3:126998541-126998563 CACGGTGGCCCCACCAGGTGTGG + Intronic
961829455 3:129615991-129616013 CACAGGGGCTCCACTGGGTGCGG + Intergenic
966912259 3:184566152-184566174 GATGCTGGCCACACTGGGTCTGG - Intronic
967807276 3:193727226-193727248 GATGTTGGCCCCACGAGGTGAGG + Intergenic
968703876 4:2069315-2069337 CTTGGTGGCCCCATGGGCTGAGG + Intergenic
968915184 4:3494161-3494183 CCTGCTGACCCCACTGGGAGAGG + Exonic
969020078 4:4134004-4134026 CATGTGGGCCCAACTGGGGGTGG + Intergenic
969179397 4:5425302-5425324 CATGGTGGCCCCACTGTCACAGG - Intronic
969733777 4:8973408-8973430 CATGTGGGTCCAACTGGGTGTGG - Intergenic
969793365 4:9507468-9507490 CATGTGGGCCCAACTGGGGGTGG - Intergenic
981179028 4:141716805-141716827 CATCCTGGGCACACTGGGTGGGG - Intronic
984070119 4:175100620-175100642 CATGGTGGAGCCAATGGATGGGG + Intergenic
985343242 4:188974797-188974819 AATGATGTCCCCACAGGGTGGGG + Intergenic
985621839 5:960091-960113 CAGGATGGGCACACTGGGTGGGG - Intergenic
985778326 5:1856948-1856970 AGTGGCGGCCCCTCTGGGTGGGG - Intergenic
985789210 5:1916260-1916282 CCTGGTGGCCCCACATGGTACGG - Intergenic
985957157 5:3274398-3274420 CATGGTAGCCACATAGGGTGAGG - Intergenic
986296824 5:6446339-6446361 CAGGGGGTCCCCGCTGGGTGTGG + Intergenic
990940719 5:61200537-61200559 CAAGGAGGCCCCACTGGTTGAGG + Intergenic
991650425 5:68847117-68847139 CATGGTGGCCAGACTGGAAGGGG + Intergenic
992449173 5:76860207-76860229 CTTGGTGGCCACAATGGGAGCGG - Intronic
993354076 5:86884431-86884453 CATGGTGGCCAAAGTGGATGAGG - Intergenic
993794325 5:92248707-92248729 TATGAAGGCCCCACTGGGGGTGG - Intergenic
994995580 5:107058258-107058280 CAAGGTGGGCACAGTGGGTGTGG + Intergenic
997425710 5:133801347-133801369 GATGGTGGTGCCACTGGCTGAGG - Intergenic
999122596 5:149220608-149220630 CCTGGTGTCCCCACTTGGTGAGG - Intronic
999736697 5:154518349-154518371 GATTGTGGCCCCATTGGCTGGGG + Intergenic
1001777127 5:174337346-174337368 CTTGGGGGCTCCACTGTGTGTGG + Intergenic
1002257518 5:177969018-177969040 CAGCATGGCCCCACAGGGTGGGG - Intergenic
1002639736 5:180625081-180625103 GAGGGTAGCCCCACTGGCTGTGG - Intronic
1002832622 6:836627-836649 CATGGGGCCCACGCTGGGTGGGG + Intergenic
1004983953 6:21059127-21059149 CAGGGAGGCCCCACTCAGTGAGG + Intronic
1006284495 6:33082111-33082133 GAAGGTGGACACACTGGGTGGGG + Intronic
1006614584 6:35317843-35317865 CAGGCTGGCCTCACTGGGTCAGG - Intronic
1006637397 6:35470297-35470319 CATGGTGGCCAAAGTGGATGAGG + Exonic
1006788940 6:36686282-36686304 GATGATGCCCCCACTCGGTGAGG - Exonic
1007097093 6:39220101-39220123 CTTGTTGGCCACACTGGGTGGGG - Intronic
1007635943 6:43299765-43299787 CATCGTGATGCCACTGGGTGAGG + Exonic
1008231285 6:48987176-48987198 CCTGGTAGCTCCACTGGGTGTGG + Intergenic
1010013362 6:71075435-71075457 CATGGTGACCCCTCTGGGATGGG + Intergenic
1014004019 6:116396767-116396789 CATGTAGGCCCCACAGTGTGAGG + Intronic
1019285233 7:219982-220004 CTTTGTGTCCACACTGGGTGTGG + Intronic
1019292582 7:257835-257857 CAGGGTGGACCCACTGCCTGGGG + Intronic
1019292680 7:258161-258183 CAGGGTGGACCCACTGCCTGAGG + Intronic
1019292691 7:258197-258219 CAGGGTGGACCCACTGACTGGGG + Intronic
1019292712 7:258269-258291 CAGGGTGGACCCACTGCCTGGGG + Intronic
1019292735 7:258341-258363 CAGGGTGGACCCACTGCCTGAGG + Intronic
1019579325 7:1752277-1752299 CATGGTGGCCCCTCTGGGTGGGG - Intergenic
1019623460 7:2003622-2003644 TCCGGTGGCCCCACTGAGTGAGG - Intronic
1021125868 7:16850938-16850960 CCTGGTGCCCCCACTGAGGGAGG + Intergenic
1024903716 7:54352219-54352241 GGTGGTGGGCACACTGGGTGGGG + Intergenic
1026928513 7:74210143-74210165 GCTCCTGGCCCCACTGGGTGGGG + Intronic
1028522493 7:91747509-91747531 CATGGTGGCCCCATTGGTTGAGG - Intronic
1029045313 7:97621595-97621617 CATGCTGGCTCCACTGCCTGAGG + Intergenic
1031963016 7:128006661-128006683 CCTGGTGACCACACTGGGTGTGG - Intronic
1032446645 7:131989893-131989915 CATGCAGCCTCCACTGGGTGGGG - Intergenic
1032819313 7:135510057-135510079 GATGGTGGCCCGTCTGGCTGTGG - Exonic
1032858784 7:135858696-135858718 CAGGGAGGCACCACTGGGAGTGG + Intergenic
1033657026 7:143381428-143381450 CAGGGCGGCCCCACGGGGAGGGG + Intronic
1034279735 7:149844720-149844742 GCTGGTGGCACCACTGGGTATGG + Exonic
1034424932 7:151009388-151009410 GATGGTGGCCCTCCTGGGGGTGG - Exonic
1035060535 7:156066228-156066250 CATGGTGGCCCATTTGAGTGGGG + Intergenic
1036737488 8:11331226-11331248 GCTGGTGGCCCTGCTGGGTGGGG + Exonic
1039415093 8:37386609-37386631 CATGGTGGCCCAGGAGGGTGGGG - Intergenic
1040468926 8:47719868-47719890 AATGCTGGCTCCCCTGGGTGTGG - Intronic
1041247747 8:55905118-55905140 CATGGTGACCTGGCTGGGTGTGG + Intronic
1049241963 8:141542532-141542554 CATGGAAGGCCCAATGGGTGGGG + Intergenic
1050258627 9:3817967-3817989 CATGGACTCCCCACTGCGTGGGG + Intergenic
1052192823 9:25678278-25678300 CGTGGTGGCGCCACTAGGCGCGG - Exonic
1053243841 9:36518471-36518493 TATGTTGGCCACACTGGGTCTGG + Intergenic
1055438522 9:76316489-76316511 CATGGTGGGCGCACTGCTTGAGG + Intronic
1056702619 9:88923749-88923771 CATGGTGCCACCAATGCGTGTGG + Intergenic
1056758894 9:89400821-89400843 CATGGTGGTCCCTCGGGGTTGGG - Intronic
1058530347 9:105900136-105900158 CAGGGAGGCCCCACCTGGTGAGG + Intergenic
1060403666 9:123362326-123362348 CAAGGAGGCCCCAGAGGGTGAGG - Intronic
1060754866 9:126205559-126205581 CATGCTGGCCACACTCGATGAGG - Intergenic
1060773385 9:126349018-126349040 CCAGGTGGCCCTACAGGGTGTGG - Intronic
1061400161 9:130364157-130364179 CATGGCGGCCCCATCAGGTGGGG + Intronic
1061670807 9:132187147-132187169 CACTGTGGCCCCCCTGGGGGAGG + Intronic
1062204075 9:135326142-135326164 CCTTGTGGCCCCCCTGCGTGTGG + Intergenic
1062542260 9:137046685-137046707 CCTGGTGGCCTCACTGAGCGCGG - Intergenic
1185469984 X:376473-376495 CATGGCGGCCCCACTGTGGACGG - Intronic
1185469999 X:376534-376556 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470015 X:376595-376617 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470031 X:376656-376678 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470047 X:376717-376739 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470062 X:376774-376796 CATGGCGGCCCCACTGTGGACGG - Intronic
1185470076 X:376831-376853 CATGGCGGCCCCACTGTGGACGG - Intronic
1185470091 X:376892-376914 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470107 X:376953-376975 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470123 X:377014-377036 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470139 X:377075-377097 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470154 X:377132-377154 CATGGCGGCCCCACTGTGGACGG - Intronic
1185470169 X:377193-377215 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470184 X:377250-377272 CATGGCGGCCCCACTGTGGACGG - Intronic
1185470199 X:377311-377333 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470214 X:377368-377390 CATGGCGGCCCCACTGTGGACGG - Intronic
1185470229 X:377429-377451 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470244 X:377486-377508 CATGGCGGCCCCACTGTGGACGG - Intronic
1185470259 X:377547-377569 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470288 X:377665-377687 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470304 X:377726-377748 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470320 X:377787-377809 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470335 X:377848-377870 CACGGCGGACCCACTGGGTGTGG - Intronic
1185470351 X:377909-377931 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185550602 X:980602-980624 CATGGCAGCCCCAGTGGGTGAGG - Intergenic
1185550635 X:980706-980728 CATGGCAGCCCCAGTGGTTGAGG - Intergenic
1186360229 X:8833442-8833464 CATAGTGGCTCCACTGGGCTAGG + Intergenic
1190027544 X:46939115-46939137 CATGGAGGCCAGGCTGGGTGTGG - Intronic
1194193522 X:90865390-90865412 CAGGGAGGCCCCACTCAGTGAGG - Intergenic
1194263990 X:91733517-91733539 TAGGGTGGCCCCACCTGGTGAGG + Intergenic
1195407103 X:104526912-104526934 CATGGTCTCCCCACTGGGATTGG + Intergenic
1197268585 X:124401967-124401989 CAAGGTAGCTCCACTGAGTGGGG + Intronic
1199084268 X:143610643-143610665 CATGGTGCCCACATCGGGTGAGG - Intergenic
1200540133 Y:4447777-4447799 CAGGGAGGCCCCACTCAGTGAGG - Intergenic
1202377431 Y:24250305-24250327 CAGGCTGGCCACATTGGGTGAGG + Intergenic
1202493349 Y:25419816-25419838 CAGGCTGGCCACATTGGGTGAGG - Intergenic