ID: 1185470288

View in Genome Browser
Species Human (GRCh38)
Location X:377665-377687
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 7, 1: 9, 2: 14, 3: 27, 4: 129}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185470288_1185470296 5 Left 1185470288 X:377665-377687 CCACACCCAGTGGGGCCGCCATG 0: 7
1: 9
2: 14
3: 27
4: 129
Right 1185470296 X:377693-377715 GTCTATACACTACTGTGTACAGG 0: 14
1: 1
2: 12
3: 5
4: 53
1185470288_1185470297 6 Left 1185470288 X:377665-377687 CCACACCCAGTGGGGCCGCCATG 0: 7
1: 9
2: 14
3: 27
4: 129
Right 1185470297 X:377694-377716 TCTATACACTACTGTGTACAGGG 0: 14
1: 1
2: 13
3: 6
4: 122
1185470288_1185470301 29 Left 1185470288 X:377665-377687 CCACACCCAGTGGGGCCGCCATG 0: 7
1: 9
2: 14
3: 27
4: 129
Right 1185470301 X:377717-377739 ACGGGCCGTCCACACCCAGTGGG 0: 15
1: 2
2: 0
3: 5
4: 45
1185470288_1185470300 28 Left 1185470288 X:377665-377687 CCACACCCAGTGGGGCCGCCATG 0: 7
1: 9
2: 14
3: 27
4: 129
Right 1185470300 X:377716-377738 GACGGGCCGTCCACACCCAGTGG 0: 15
1: 2
2: 1
3: 7
4: 67
1185470288_1185470299 11 Left 1185470288 X:377665-377687 CCACACCCAGTGGGGCCGCCATG 0: 7
1: 9
2: 14
3: 27
4: 129
Right 1185470299 X:377699-377721 ACACTACTGTGTACAGGGACGGG 0: 14
1: 1
2: 14
3: 7
4: 113
1185470288_1185470302 30 Left 1185470288 X:377665-377687 CCACACCCAGTGGGGCCGCCATG 0: 7
1: 9
2: 14
3: 27
4: 129
Right 1185470302 X:377718-377740 CGGGCCGTCCACACCCAGTGGGG 0: 14
1: 2
2: 1
3: 14
4: 119
1185470288_1185470298 10 Left 1185470288 X:377665-377687 CCACACCCAGTGGGGCCGCCATG 0: 7
1: 9
2: 14
3: 27
4: 129
Right 1185470298 X:377698-377720 TACACTACTGTGTACAGGGACGG 0: 14
1: 1
2: 13
3: 13
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185470288 Original CRISPR CATGGCGGCCCCACTGGGTG TGG (reversed) Intronic
901314395 1:8296084-8296106 CATGGTGGCCCCACAGGCTGAGG + Intergenic
904979704 1:34488228-34488250 CATGGCTGTCCAACTGGTTGTGG - Intergenic
905632295 1:39525412-39525434 CATGGCAGCCCCAGGGTGTGGGG - Intronic
907826059 1:58017822-58017844 CATGGTAGCCCCTCTAGGTGGGG + Intronic
910501815 1:87900840-87900862 TAGGGCTTCCCCACTGGGTGGGG + Intergenic
921833874 1:219758330-219758352 AATGGCAGTCCCACTGGGTTTGG + Intronic
1063572385 10:7228179-7228201 CATGGCGGCACCAGCCGGTGGGG + Intronic
1067306665 10:45071041-45071063 CATTGTGGCCCCACTGCCTGGGG - Intergenic
1067701476 10:48576152-48576174 TATGGGCTCCCCACTGGGTGTGG + Intronic
1072462539 10:95633001-95633023 CCTGGCTGCCCGACTGGCTGTGG - Exonic
1073147297 10:101289281-101289303 CATGGCATTCCCACAGGGTGAGG + Intergenic
1076449847 10:130549401-130549423 CAAGGGAGCCCCACTGTGTGAGG + Intergenic
1076618977 10:131775018-131775040 CAGGGAGGCCCCACAGAGTGTGG - Intergenic
1076629584 10:131844196-131844218 CATGGCGGCCTCGGTGGGGGCGG - Intergenic
1077295823 11:1825810-1825832 CGTGCAGGCCCCACTGTGTGCGG - Intergenic
1077327507 11:1970073-1970095 CCTGGCGGCCTCACTGGGGGAGG - Intronic
1077443072 11:2577756-2577778 CAGGGCGGCCCCACGGGGGCTGG + Intronic
1079401713 11:20111278-20111300 CCTGGCATCCCCACTGGGTCAGG - Intronic
1080306302 11:30840314-30840336 CAGGGCAGCCCCACTTGGCGTGG + Intronic
1080577085 11:33609697-33609719 CCTGCCGGCCCCACTGGGTCAGG + Intronic
1083655448 11:64227000-64227022 TCTGGCGGACCCACTGGGGGTGG + Exonic
1084288215 11:68145580-68145602 CCTGGCTGCCCCACTGGGGGTGG + Intergenic
1085309637 11:75508682-75508704 CATGGGGGCCACAGTGGGGGAGG - Intronic
1088728137 11:112657434-112657456 CTTGTGGGCCCCCCTGGGTGTGG - Intergenic
1089607900 11:119652226-119652248 CATGGTGACCACACCGGGTGGGG - Intronic
1090439190 11:126712342-126712364 CAAGGCGGCCTCTCTGAGTGAGG + Intronic
1090869565 11:130731229-130731251 GATTGGGGCCCCGCTGGGTGTGG + Intergenic
1202810489 11_KI270721v1_random:25253-25275 CCTGGCGGCCTCGCTGGGGGAGG - Intergenic
1094458652 12:30668728-30668750 TATGGGGGCCCTACTGTGTGTGG - Intronic
1102646416 12:114406698-114406720 TCTGGTGGCCCCACTGGGTGGGG - Intronic
1103792208 12:123479681-123479703 CGTGGCAGCCCCACTTGCTGGGG - Intronic
1103910341 12:124348639-124348661 CATGTCGGCACCCGTGGGTGTGG - Intronic
1104104155 12:125643182-125643204 TGTGGTGGCCCCACTGGTTGAGG + Intronic
1107435260 13:40376020-40376042 CATGATGGCCCCACTGGGAAGGG + Intergenic
1108957801 13:56182817-56182839 CAGGGAGGCCCCACTCAGTGAGG - Intergenic
1122290324 14:100677414-100677436 TCTTGCCGCCCCACTGGGTGAGG + Intergenic
1128450806 15:67804982-67805004 CATGGAGGCCAGGCTGGGTGTGG - Intronic
1128505939 15:68272788-68272810 CATAGGAGCCACACTGGGTGTGG - Intergenic
1129944496 15:79527211-79527233 CATGGCGCTCCCCCTGTGTGTGG + Intergenic
1130870734 15:87969913-87969935 GATGGCTGCCCCTTTGGGTGAGG - Intronic
1132545901 16:533339-533361 CATGGCGGACCCACTGCGGTGGG - Intronic
1132972871 16:2697470-2697492 CATGGCCACGCCACTGGGTGGGG - Intronic
1134494840 16:14724704-14724726 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134500223 16:14763824-14763846 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134526765 16:14950436-14950458 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134545641 16:15105912-15105934 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134580356 16:15365226-15365248 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134714342 16:16348913-16348935 GATGGGGGCCCCACTGGGTGGGG - Intergenic
1134722217 16:16392277-16392299 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134945210 16:18319592-18319614 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134952474 16:18359745-18359767 GATGGGGGCCCCACTGGGTGGGG + Intergenic
1136496897 16:30650583-30650605 CATGGCGGCGCCACTCAGTTTGG + Intergenic
1137568323 16:49548151-49548173 CTTGGAGGACCCACTGGGTGAGG - Intronic
1139511622 16:67431229-67431251 CATGGCGGCCCAGCGGGCTGGGG - Exonic
1139719837 16:68843617-68843639 CATGGCGGCCCGACAGGCCGTGG + Exonic
1139942205 16:70613385-70613407 CATGGCGGCCACACTGGATGGGG + Intronic
1141545091 16:84761521-84761543 CCTTGTGGCCCCACTGGGAGAGG - Intronic
1142808549 17:2384657-2384679 CCAGGCGGTCCCACAGGGTGAGG + Exonic
1144703078 17:17351196-17351218 CCTGACGACCCCACGGGGTGAGG - Intergenic
1144803657 17:17949392-17949414 CAAGGAGGCCCAACTGGGTCAGG + Intronic
1145123848 17:20284261-20284283 CACAGCAGCCCCACTGGCTGAGG + Intronic
1148773541 17:50080272-50080294 CAGGGCGTGCCCACTGTGTGTGG + Exonic
1151908696 17:77066881-77066903 CAGGGCGGCCCCCTTGGGAGGGG - Intergenic
1152644669 17:81463245-81463267 CAGGGAGGGCCCACGGGGTGGGG - Intronic
1152905876 17:82970662-82970684 CATCACGGCCACGCTGGGTGCGG - Intronic
1154502052 18:15001957-15001979 CGTGCAGCCCCCACTGGGTGCGG - Intergenic
1155429848 18:25743857-25743879 CAGGGAGGCCCCACCTGGTGAGG - Intergenic
1155705987 18:28813421-28813443 CATGGCGGCAGCATTTGGTGAGG + Intergenic
1159655894 18:71030224-71030246 CATGCCTGAGCCACTGGGTGAGG - Intergenic
1159953978 18:74506697-74506719 CCTGGCTGCCCCAGTGGGGGTGG + Intronic
1160388393 18:78512055-78512077 CATGGCGGCCCCACTGCCAGTGG - Intergenic
1161083526 19:2323167-2323189 CTTGGCGGCCTCACTGGGGAGGG + Intronic
1161361997 19:3855687-3855709 CATGGCGGGCCTGGTGGGTGAGG + Intronic
1161544197 19:4870068-4870090 AACTGCGGCCCCACCGGGTGTGG - Intergenic
1161796985 19:6392974-6392996 CATGGCGGCCCTAGTGAGTGTGG - Exonic
1163268697 19:16236208-16236230 CATGGGGGCTCCACAGGGTGGGG - Intronic
1163533309 19:17863102-17863124 CTTGGTGGCCCCACAGGATGGGG + Intronic
1164599761 19:29552891-29552913 CAGGGAGGCCCCACCAGGTGAGG - Intronic
1164610257 19:29626938-29626960 CACTGTGTCCCCACTGGGTGTGG + Intergenic
1165114582 19:33521484-33521506 TCTGGCGGCCCCACCGTGTGCGG - Intronic
1167145654 19:47679845-47679867 CACGGCGGCCACACTGGGCCTGG + Exonic
925182103 2:1823999-1824021 CCCGGCGGCCCCGCTGGGGGGGG - Intronic
925555739 2:5130000-5130022 CATGGCGAGGCCACTGGGTGTGG + Intergenic
926421441 2:12703747-12703769 AATAGTGGCCCCACAGGGTGGGG - Intergenic
927502483 2:23591829-23591851 CAGGGCAGCCCCCCTGGGAGCGG + Intronic
928286750 2:29996684-29996706 CCTGGCTGCCCCACTGGCAGGGG + Intergenic
929615225 2:43301476-43301498 CATGGAGCTCCAACTGGGTGGGG + Intronic
938501230 2:131832129-131832151 CATGCAGCCCCCACTGGGTGTGG - Intergenic
939933362 2:148258816-148258838 CATGGGGGCCCCCCTGTGGGTGG + Intronic
940410747 2:153360646-153360668 CAGGGAGGCCCCACCTGGTGAGG - Intergenic
944601652 2:201309404-201309426 CATGGAGGACCCACTCAGTGAGG - Intronic
944743662 2:202635338-202635360 CATGGCAGCCCCACGCGGAGCGG + Exonic
1171164489 20:22958049-22958071 CCTGGCAACCCTACTGGGTGTGG + Intergenic
1173354047 20:42270333-42270355 CCTGGAGGACCCACTGAGTGTGG + Intronic
1174294981 20:49539539-49539561 CATGGGGGCCCCAGTGGGTGGGG - Intronic
1174353841 20:49985672-49985694 AATGGTGGGCCCAGTGGGTGGGG + Intronic
1175591932 20:60200313-60200335 CAGGGAGGCCCTATTGGGTGAGG + Intergenic
1175739662 20:61411857-61411879 CAGGGCAGCCCCACTGCCTGTGG - Intronic
1175787824 20:61723266-61723288 AAGGGCAGCCTCACTGGGTGAGG + Intronic
1176231218 20:64034060-64034082 CATGGCTGGCCCAGAGGGTGTGG + Intronic
1176425855 21:6547772-6547794 CAGGGCGGAACCTCTGGGTGGGG + Intergenic
1179701346 21:43156089-43156111 CAGGGCGGAACCTCTGGGTGGGG + Intergenic
1180160965 21:45998558-45998580 CACGGCTGCCCCACTGTCTGTGG + Intronic
1182338563 22:29601681-29601703 CACAGCAGCCTCACTGGGTGTGG + Intergenic
1183462793 22:37962513-37962535 TATGGCTGTCACACTGGGTGTGG - Intronic
1184291923 22:43501962-43501984 CATGGCGGCCCCTCTCTGTTTGG - Intronic
1185346290 22:50312256-50312278 CATGGCTGCCCCTCCAGGTGCGG - Exonic
950433898 3:12967449-12967471 CATGGCGGCCGCAGTGGGAGCGG + Exonic
952491323 3:33876455-33876477 CATGGGGGCCCCTCTGGGCCTGG + Intergenic
953383947 3:42494078-42494100 CACGGCTGCCCCACTGGGGAAGG - Intronic
954405124 3:50341200-50341222 CTTGGCCTACCCACTGGGTGGGG + Exonic
955707399 3:61742658-61742680 CATGGTGGCCAAAGTGGGTGAGG - Intronic
961380862 3:126495852-126495874 CATGGTGGCCACACTGGGAGGGG - Intronic
961450038 3:126998541-126998563 CACGGTGGCCCCACCAGGTGTGG + Intronic
961829455 3:129615991-129616013 CACAGGGGCTCCACTGGGTGCGG + Intergenic
968504827 4:966918-966940 CATGCCGGCCAGACTCGGTGGGG - Intronic
969020078 4:4134004-4134026 CATGTGGGCCCAACTGGGGGTGG + Intergenic
969716824 4:8871862-8871884 CGGGGCGGCCTCACTGGGGGCGG + Intergenic
969733777 4:8973408-8973430 CATGTGGGTCCAACTGGGTGTGG - Intergenic
969793365 4:9507468-9507490 CATGTGGGCCCAACTGGGGGTGG - Intergenic
983957603 4:173715983-173716005 TGGGGCGGCCCCACTTGGTGAGG - Intergenic
985778326 5:1856948-1856970 AGTGGCGGCCCCTCTGGGTGGGG - Intergenic
986296824 5:6446339-6446361 CAGGGGGTCCCCGCTGGGTGTGG + Intergenic
990940719 5:61200537-61200559 CAAGGAGGCCCCACTGGTTGAGG + Intergenic
993794325 5:92248707-92248729 TATGAAGGCCCCACTGGGGGTGG - Intergenic
997302173 5:132813997-132814019 CCTGGCGGCTCCACTGGCCGCGG - Exonic
997695375 5:135857084-135857106 CTTGGCGTCCCAGCTGGGTGAGG - Intronic
999122596 5:149220608-149220630 CCTGGTGTCCCCACTTGGTGAGG - Intronic
1001777127 5:174337346-174337368 CTTGGGGGCTCCACTGTGTGTGG + Intergenic
1002832622 6:836627-836649 CATGGGGCCCACGCTGGGTGGGG + Intergenic
1004983953 6:21059127-21059149 CAGGGAGGCCCCACTCAGTGAGG + Intronic
1007097093 6:39220101-39220123 CTTGTTGGCCACACTGGGTGGGG - Intronic
1008231285 6:48987176-48987198 CCTGGTAGCTCCACTGGGTGTGG + Intergenic
1010850336 6:80767998-80768020 CTTGGCAGCCTCACTGGGAGGGG + Intergenic
1013599011 6:111686507-111686529 TATGGCGGCACCACTGAGTTGGG + Intronic
1014004019 6:116396767-116396789 CATGTAGGCCCCACAGTGTGAGG + Intronic
1019579325 7:1752277-1752299 CATGGTGGCCCCTCTGGGTGGGG - Intergenic
1028522493 7:91747509-91747531 CATGGTGGCCCCATTGGTTGAGG - Intronic
1031963016 7:128006661-128006683 CCTGGTGACCACACTGGGTGTGG - Intronic
1032446645 7:131989893-131989915 CATGCAGCCTCCACTGGGTGGGG - Intergenic
1032858784 7:135858696-135858718 CAGGGAGGCACCACTGGGAGTGG + Intergenic
1033657026 7:143381428-143381450 CAGGGCGGCCCCACGGGGAGGGG + Intronic
1036808162 8:11849178-11849200 CATGGCAGCCTCACCCGGTGGGG - Intronic
1040545118 8:48393069-48393091 CATGGCAGCACCAATGAGTGAGG + Intergenic
1045063579 8:98427360-98427382 CCGGGCAGCCCCGCTGGGTGAGG + Intronic
1048970332 8:139641748-139641770 CATGGCTGCCCTCCTGGGGGAGG + Intronic
1049200333 8:141336963-141336985 CACGGCGGCCCAGCTGTGTGTGG + Intergenic
1049241963 8:141542532-141542554 CATGGAAGGCCCAATGGGTGGGG + Intergenic
1050258627 9:3817967-3817989 CATGGACTCCCCACTGCGTGGGG + Intergenic
1058530347 9:105900136-105900158 CAGGGAGGCCCCACCTGGTGAGG + Intergenic
1060403666 9:123362326-123362348 CAAGGAGGCCCCAGAGGGTGAGG - Intronic
1061400161 9:130364157-130364179 CATGGCGGCCCCATCAGGTGGGG + Intronic
1062110677 9:134780486-134780508 CAAGGCGGCCCACCTGGGAGTGG - Intronic
1062462334 9:136667108-136667130 CTGGCCAGCCCCACTGGGTGTGG - Intronic
1185469984 X:376473-376495 CATGGCGGCCCCACTGTGGACGG - Intronic
1185469999 X:376534-376556 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470015 X:376595-376617 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470031 X:376656-376678 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470047 X:376717-376739 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470062 X:376774-376796 CATGGCGGCCCCACTGTGGACGG - Intronic
1185470076 X:376831-376853 CATGGCGGCCCCACTGTGGACGG - Intronic
1185470091 X:376892-376914 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470107 X:376953-376975 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470123 X:377014-377036 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470139 X:377075-377097 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470154 X:377132-377154 CATGGCGGCCCCACTGTGGACGG - Intronic
1185470169 X:377193-377215 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470184 X:377250-377272 CATGGCGGCCCCACTGTGGACGG - Intronic
1185470199 X:377311-377333 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470214 X:377368-377390 CATGGCGGCCCCACTGTGGACGG - Intronic
1185470229 X:377429-377451 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470244 X:377486-377508 CATGGCGGCCCCACTGTGGACGG - Intronic
1185470259 X:377547-377569 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470274 X:377604-377626 CATGGCGGCCCCACTGTAGACGG - Intronic
1185470288 X:377665-377687 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470304 X:377726-377748 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470320 X:377787-377809 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470335 X:377848-377870 CACGGCGGACCCACTGGGTGTGG - Intronic
1185470351 X:377909-377931 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470366 X:377966-377988 CATGGCGGCCCCACTGTAGACGG - Intronic
1185550602 X:980602-980624 CATGGCAGCCCCAGTGGGTGAGG - Intergenic
1185550635 X:980706-980728 CATGGCAGCCCCAGTGGTTGAGG - Intergenic
1190027544 X:46939115-46939137 CATGGAGGCCAGGCTGGGTGTGG - Intronic
1194193522 X:90865390-90865412 CAGGGAGGCCCCACTCAGTGAGG - Intergenic
1200540133 Y:4447777-4447799 CAGGGAGGCCCCACTCAGTGAGG - Intergenic
1201975651 Y:19845975-19845997 CCTGGCAGTCACACTGGGTGTGG + Intergenic