ID: 1185470335

View in Genome Browser
Species Human (GRCh38)
Location X:377848-377870
Sequence CACGGCGGACCCACTGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 7, 3: 15, 4: 101}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185470335_1185470343 5 Left 1185470335 X:377848-377870 CCACACCCAGTGGGTCCGCCGTG 0: 1
1: 0
2: 7
3: 15
4: 101
Right 1185470343 X:377876-377898 GTCTATACACTACTGTGTACAGG 0: 14
1: 1
2: 12
3: 5
4: 53
1185470335_1185470348 29 Left 1185470335 X:377848-377870 CCACACCCAGTGGGTCCGCCGTG 0: 1
1: 0
2: 7
3: 15
4: 101
Right 1185470348 X:377900-377922 ACGGGCCATCCACACCCAGTGGG 0: 2
1: 15
2: 1
3: 7
4: 60
1185470335_1185470346 11 Left 1185470335 X:377848-377870 CCACACCCAGTGGGTCCGCCGTG 0: 1
1: 0
2: 7
3: 15
4: 101
Right 1185470346 X:377882-377904 ACACTACTGTGTACAGGGACGGG 0: 14
1: 1
2: 14
3: 7
4: 113
1185470335_1185470349 30 Left 1185470335 X:377848-377870 CCACACCCAGTGGGTCCGCCGTG 0: 1
1: 0
2: 7
3: 15
4: 101
Right 1185470349 X:377901-377923 CGGGCCATCCACACCCAGTGGGG 0: 2
1: 14
2: 2
3: 15
4: 142
1185470335_1185470345 10 Left 1185470335 X:377848-377870 CCACACCCAGTGGGTCCGCCGTG 0: 1
1: 0
2: 7
3: 15
4: 101
Right 1185470345 X:377881-377903 TACACTACTGTGTACAGGGACGG 0: 14
1: 1
2: 13
3: 13
4: 128
1185470335_1185470347 28 Left 1185470335 X:377848-377870 CCACACCCAGTGGGTCCGCCGTG 0: 1
1: 0
2: 7
3: 15
4: 101
Right 1185470347 X:377899-377921 GACGGGCCATCCACACCCAGTGG 0: 2
1: 15
2: 1
3: 6
4: 79
1185470335_1185470344 6 Left 1185470335 X:377848-377870 CCACACCCAGTGGGTCCGCCGTG 0: 1
1: 0
2: 7
3: 15
4: 101
Right 1185470344 X:377877-377899 TCTATACACTACTGTGTACAGGG 0: 14
1: 1
2: 13
3: 6
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185470335 Original CRISPR CACGGCGGACCCACTGGGTG TGG (reversed) Intronic
901018142 1:6243158-6243180 TACGGCGGACCCAGTGGAGGAGG - Intergenic
915511330 1:156388519-156388541 CGCGGCGGACCGGCTGGGAGTGG - Intergenic
915687541 1:157649836-157649858 CACTAAGGACCCACTGGGTGAGG - Intergenic
921337891 1:214107142-214107164 TACAGAGGACCCCCTGGGTGTGG + Intergenic
1065659904 10:27995133-27995155 CACGGTGGATCCCATGGGTGTGG - Exonic
1067135859 10:43606675-43606697 CACGGCGCAGCCACTGCGGGTGG - Intronic
1070321466 10:75357981-75358003 CACTGAGCACCCACTGGGTCTGG - Intergenic
1074087830 10:110222053-110222075 CAAGGCTGACTCACTGGGCGAGG + Intronic
1074507956 10:114087866-114087888 CACAGGAGAGCCACTGGGTGGGG - Intergenic
1075746903 10:124734414-124734436 CAAGGAGGACACAGTGGGTGAGG + Intronic
1077102760 11:829451-829473 CACGGCGGGCTCTCTGGATGAGG + Exonic
1077189143 11:1248570-1248592 CACCGTGGAGCCACTGGTTGTGG - Exonic
1077189712 11:1250769-1250791 CACCGTGGAGCCACTGGTTGTGG - Exonic
1081486834 11:43537491-43537513 CCCTGCAGACCCACTGGGCGAGG - Intergenic
1083406710 11:62462330-62462352 AACTGCTGATCCACTGGGTGTGG - Intronic
1083655448 11:64227000-64227022 TCTGGCGGACCCACTGGGGGTGG + Exonic
1084730839 11:71072339-71072361 CACGGTGCACACACTGGGCGGGG + Intronic
1087936292 11:104037425-104037447 CACAGCCGACCCACTGGATCGGG + Exonic
1101440546 12:104701452-104701474 CCCGGCGGGCACACTGCGTGGGG + Intronic
1102742721 12:115222562-115222584 CACTGAGGACCTACTGTGTGGGG + Intergenic
1113717205 13:112519827-112519849 CACCGAGGACCCACTGGGCCGGG - Intronic
1117531779 14:56666742-56666764 GACGGTGGACACAATGGGTGAGG - Intronic
1122773194 14:104106227-104106249 CACGTTGTACCCGCTGGGTGTGG + Intronic
1130746296 15:86657427-86657449 CAGGGCAGAACCACTGTGTGTGG + Intronic
1132215510 15:100058811-100058833 CACGGAGGAGTCACTGGGTATGG + Intronic
1132545901 16:533339-533361 CATGGCGGACCCACTGCGGTGGG - Intronic
1132618384 16:853217-853239 CACGGCTGAGCCACTGTGGGGGG - Intergenic
1132846698 16:2004029-2004051 CAGGGTGGAGCCACCGGGTGAGG - Intronic
1134494840 16:14724704-14724726 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134500223 16:14763824-14763846 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134526765 16:14950436-14950458 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134545641 16:15105912-15105934 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134580356 16:15365226-15365248 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134714342 16:16348913-16348935 GATGGGGGCCCCACTGGGTGGGG - Intergenic
1134722217 16:16392277-16392299 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134945210 16:18319592-18319614 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134952474 16:18359745-18359767 GATGGGGGCCCCACTGGGTGGGG + Intergenic
1137568323 16:49548151-49548173 CTTGGAGGACCCACTGGGTGAGG - Intronic
1139942205 16:70613385-70613407 CATGGCGGCCACACTGGATGGGG + Intronic
1141944804 16:87302683-87302705 GACAGCAGACCCACTGGATGAGG - Intronic
1142808549 17:2384657-2384679 CCAGGCGGTCCCACAGGGTGAGG + Exonic
1143115648 17:4580538-4580560 CACGGAGGTCTCACTGTGTGGGG - Intergenic
1145123848 17:20284261-20284283 CACAGCAGCCCCACTGGCTGAGG + Intronic
1146182437 17:30706824-30706846 GACTGCAGACCCACTGGGTATGG - Intergenic
1148773541 17:50080272-50080294 CAGGGCGTGCCCACTGTGTGTGG + Exonic
1152644669 17:81463245-81463267 CAGGGAGGGCCCACGGGGTGGGG - Intronic
1152783020 17:82234777-82234799 CACGGGGGACCCACCGGGTCAGG + Exonic
1157881569 18:51325849-51325871 CACTGCAGACTCACTGTGTGGGG - Intergenic
1159655894 18:71030224-71030246 CATGCCTGAGCCACTGGGTGAGG - Intergenic
1161544197 19:4870068-4870090 AACTGCGGCCCCACCGGGTGTGG - Intergenic
1164578551 19:29419996-29420018 CACGCAGCACCCACTGGCTGGGG + Intergenic
1164610257 19:29626938-29626960 CACTGTGTCCCCACTGGGTGTGG + Intergenic
1165320284 19:35080707-35080729 CACGGTGGAGCAACTGGCTGGGG - Intergenic
1165781102 19:38434737-38434759 CCCTGCGGAGCCACTGGGAGGGG - Intronic
1167145654 19:47679845-47679867 CACGGCGGCCACACTGGGCCTGG + Exonic
1167382482 19:49146551-49146573 CAAGGAGGACACACTGGCTGTGG + Intronic
925182103 2:1823999-1824021 CCCGGCGGCCCCGCTGGGGGGGG - Intronic
925555739 2:5130000-5130022 CATGGCGAGGCCACTGGGTGTGG + Intergenic
925599194 2:5590771-5590793 CAGGGCAGAGCCACAGGGTGCGG - Intergenic
929860177 2:45670149-45670171 CGCGGCCGACTTACTGGGTGGGG - Intronic
944601652 2:201309404-201309426 CATGGAGGACCCACTCAGTGAGG - Intronic
1173354047 20:42270333-42270355 CCTGGAGGACCCACTGAGTGTGG + Intronic
1174294981 20:49539539-49539561 CATGGGGGCCCCAGTGGGTGGGG - Intronic
1175986923 20:62768621-62768643 CTCGGCAGACCTGCTGGGTGGGG - Intergenic
1176425855 21:6547772-6547794 CAGGGCGGAACCTCTGGGTGGGG + Intergenic
1179025294 21:37674506-37674528 CTCGGCGGAGCCAGTGGGTGAGG - Intronic
1179701346 21:43156089-43156111 CAGGGCGGAACCTCTGGGTGGGG + Intergenic
1180160965 21:45998558-45998580 CACGGCTGCCCCACTGTCTGTGG + Intronic
1180793825 22:18592217-18592239 CTCTGCAGAGCCACTGGGTGGGG - Intergenic
1181227915 22:21403103-21403125 CTCTGCAGAGCCACTGGGTGGGG + Intergenic
1181250738 22:21531736-21531758 CTCTGCAGAGCCACTGGGTGGGG - Intergenic
1182338563 22:29601681-29601703 CACAGCAGCCTCACTGGGTGTGG + Intergenic
953383947 3:42494078-42494100 CACGGCTGCCCCACTGGGGAAGG - Intronic
954374011 3:50184842-50184864 CACGCTGGGCCCACCGGGTGCGG + Intronic
954405124 3:50341200-50341222 CTTGGCCTACCCACTGGGTGGGG + Exonic
954671485 3:52293508-52293530 CACGGGGGAGCCGCTGGGAGGGG + Intergenic
957209448 3:77240372-77240394 CTCGGCGGGCCCACTCGGAGCGG - Intronic
961450038 3:126998541-126998563 CACGGTGGCCCCACCAGGTGTGG + Intronic
961829455 3:129615991-129616013 CACAGGGGCTCCACTGGGTGCGG + Intergenic
967880863 3:194300373-194300395 CACGTCGGAGAGACTGGGTGTGG - Intergenic
968340194 3:197949359-197949381 TACGGAGGACCTACTAGGTGCGG + Intronic
990940719 5:61200537-61200559 CAAGGAGGCCCCACTGGTTGAGG + Intergenic
994144741 5:96382427-96382449 CAGGGAGGATCCACTGGGGGTGG - Intergenic
1002709943 5:181189341-181189363 AACGCCGGACCGGCTGGGTGAGG + Intergenic
1006284495 6:33082111-33082133 GAAGGTGGACACACTGGGTGGGG + Intronic
1013991473 6:116258720-116258742 CCCGGCGCACCCAATGCGTGTGG + Intronic
1015785755 6:136921218-136921240 CACGACGGTCCCGCAGGGTGAGG + Intergenic
1018762241 6:166902690-166902712 CACGGCCCACCCACTAGATGTGG + Intronic
1019292582 7:257835-257857 CAGGGTGGACCCACTGCCTGGGG + Intronic
1019292680 7:258161-258183 CAGGGTGGACCCACTGCCTGAGG + Intronic
1019292691 7:258197-258219 CAGGGTGGACCCACTGACTGGGG + Intronic
1019292712 7:258269-258291 CAGGGTGGACCCACTGCCTGGGG + Intronic
1019292735 7:258341-258363 CAGGGTGGACCCACTGCCTGAGG + Intronic
1019579325 7:1752277-1752299 CATGGTGGCCCCTCTGGGTGGGG - Intergenic
1020085695 7:5309019-5309041 CAGGGCTGACCCACTGGGCAGGG + Intronic
1025208617 7:57008145-57008167 CAGGGCTGACCCACTGGGCAGGG - Intergenic
1025663330 7:63568733-63568755 CAGGGCTGACCCACTGGGCAGGG + Intergenic
1029544065 7:101201213-101201235 CACCTGGGACCCAGTGGGTGGGG - Intergenic
1033657026 7:143381428-143381450 CAGGGCGGCCCCACGGGGAGGGG + Intronic
1039916792 8:41865950-41865972 CACTGCAGACCCATTGAGTGTGG - Intronic
1043092577 8:75924305-75924327 CACGGAGGTCCCACCTGGTGTGG - Intergenic
1049176636 8:141196908-141196930 CACGGCAGACGCACTGGGGCCGG + Intergenic
1049200333 8:141336963-141336985 CACGGCGGCCCAGCTGTGTGTGG + Intergenic
1052876788 9:33573862-33573884 CACAAGGTACCCACTGGGTGAGG - Intergenic
1185469999 X:376534-376556 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470015 X:376595-376617 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470031 X:376656-376678 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470047 X:376717-376739 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470091 X:376892-376914 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470107 X:376953-376975 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470123 X:377014-377036 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470139 X:377075-377097 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470169 X:377193-377215 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470199 X:377311-377333 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470229 X:377429-377451 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470259 X:377547-377569 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470288 X:377665-377687 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470304 X:377726-377748 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470320 X:377787-377809 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470335 X:377848-377870 CACGGCGGACCCACTGGGTGTGG - Intronic
1185470351 X:377909-377931 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185550602 X:980602-980624 CATGGCAGCCCCAGTGGGTGAGG - Intergenic
1187261835 X:17691934-17691956 CCCGGCCCACCCACTGGGTACGG - Intronic
1201304207 Y:12536906-12536928 CAAAGAGCACCCACTGGGTGAGG + Intergenic