ID: 1185471604

View in Genome Browser
Species Human (GRCh38)
Location X:387000-387022
Sequence GGGGCGCGCGTGGCTAGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185471604_1185471621 28 Left 1185471604 X:387000-387022 CCGCCGCTAGCCACGCGCGCCCC No data
Right 1185471621 X:387051-387073 TTGGTGGGGCCGAGCGGCTGCGG No data
1185471604_1185471618 13 Left 1185471604 X:387000-387022 CCGCCGCTAGCCACGCGCGCCCC No data
Right 1185471618 X:387036-387058 CTTTTGCAGGAGGCTTTGGTGGG No data
1185471604_1185471612 0 Left 1185471604 X:387000-387022 CCGCCGCTAGCCACGCGCGCCCC No data
Right 1185471612 X:387023-387045 GCGGCCCTCGGAGCTTTTGCAGG No data
1185471604_1185471617 12 Left 1185471604 X:387000-387022 CCGCCGCTAGCCACGCGCGCCCC No data
Right 1185471617 X:387035-387057 GCTTTTGCAGGAGGCTTTGGTGG No data
1185471604_1185471616 9 Left 1185471604 X:387000-387022 CCGCCGCTAGCCACGCGCGCCCC No data
Right 1185471616 X:387032-387054 GGAGCTTTTGCAGGAGGCTTTGG No data
1185471604_1185471620 22 Left 1185471604 X:387000-387022 CCGCCGCTAGCCACGCGCGCCCC No data
Right 1185471620 X:387045-387067 GAGGCTTTGGTGGGGCCGAGCGG No data
1185471604_1185471619 14 Left 1185471604 X:387000-387022 CCGCCGCTAGCCACGCGCGCCCC No data
Right 1185471619 X:387037-387059 TTTTGCAGGAGGCTTTGGTGGGG No data
1185471604_1185471613 3 Left 1185471604 X:387000-387022 CCGCCGCTAGCCACGCGCGCCCC No data
Right 1185471613 X:387026-387048 GCCCTCGGAGCTTTTGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185471604 Original CRISPR GGGGCGCGCGTGGCTAGCGG CGG (reversed) Intergenic
No off target data available for this crispr