ID: 1185473704

View in Genome Browser
Species Human (GRCh38)
Location X:400480-400502
Sequence CGCTATTTTTGGAGGGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185473694_1185473704 16 Left 1185473694 X:400441-400463 CCTCTGTGCCCGTCACTCGATCG No data
Right 1185473704 X:400480-400502 CGCTATTTTTGGAGGGCAGCTGG No data
1185473697_1185473704 8 Left 1185473697 X:400449-400471 CCCGTCACTCGATCGTGGGCCTG No data
Right 1185473704 X:400480-400502 CGCTATTTTTGGAGGGCAGCTGG No data
1185473698_1185473704 7 Left 1185473698 X:400450-400472 CCGTCACTCGATCGTGGGCCTGC No data
Right 1185473704 X:400480-400502 CGCTATTTTTGGAGGGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185473704 Original CRISPR CGCTATTTTTGGAGGGCAGC TGG Intergenic
No off target data available for this crispr