ID: 1185478316

View in Genome Browser
Species Human (GRCh38)
Location X:428249-428271
Sequence CGGAATCTTGCAAGTGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185478316_1185478323 -2 Left 1185478316 X:428249-428271 CCTCCCACACTTGCAAGATTCCG No data
Right 1185478323 X:428270-428292 CGAGGGAGGAAGCCGCTTCTCGG No data
1185478316_1185478324 4 Left 1185478316 X:428249-428271 CCTCCCACACTTGCAAGATTCCG No data
Right 1185478324 X:428276-428298 AGGAAGCCGCTTCTCGGACCCGG No data
1185478316_1185478325 5 Left 1185478316 X:428249-428271 CCTCCCACACTTGCAAGATTCCG No data
Right 1185478325 X:428277-428299 GGAAGCCGCTTCTCGGACCCGGG No data
1185478316_1185478329 26 Left 1185478316 X:428249-428271 CCTCCCACACTTGCAAGATTCCG No data
Right 1185478329 X:428298-428320 GGTCCCAAGCTGTGCAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185478316 Original CRISPR CGGAATCTTGCAAGTGTGGG AGG (reversed) Intergenic
No off target data available for this crispr