ID: 1185483930

View in Genome Browser
Species Human (GRCh38)
Location X:468183-468205
Sequence CAGGCTGGAGGCTCTGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185483930_1185483934 -10 Left 1185483930 X:468183-468205 CCTCCTTCAGAGCCTCCAGCCTG No data
Right 1185483934 X:468196-468218 CTCCAGCCTGGCCTTGAGACCGG No data
1185483930_1185483939 13 Left 1185483930 X:468183-468205 CCTCCTTCAGAGCCTCCAGCCTG No data
Right 1185483939 X:468219-468241 CTCACCACATGTGAGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185483930 Original CRISPR CAGGCTGGAGGCTCTGAAGG AGG (reversed) Intergenic
No off target data available for this crispr