ID: 1185483939

View in Genome Browser
Species Human (GRCh38)
Location X:468219-468241
Sequence CTCACCACATGTGAGCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185483932_1185483939 10 Left 1185483932 X:468186-468208 CCTTCAGAGCCTCCAGCCTGGCC No data
Right 1185483939 X:468219-468241 CTCACCACATGTGAGCAGCCAGG No data
1185483930_1185483939 13 Left 1185483930 X:468183-468205 CCTCCTTCAGAGCCTCCAGCCTG No data
Right 1185483939 X:468219-468241 CTCACCACATGTGAGCAGCCAGG No data
1185483936_1185483939 -6 Left 1185483936 X:468202-468224 CCTGGCCTTGAGACCGGCTCACC No data
Right 1185483939 X:468219-468241 CTCACCACATGTGAGCAGCCAGG No data
1185483933_1185483939 1 Left 1185483933 X:468195-468217 CCTCCAGCCTGGCCTTGAGACCG No data
Right 1185483939 X:468219-468241 CTCACCACATGTGAGCAGCCAGG No data
1185483935_1185483939 -2 Left 1185483935 X:468198-468220 CCAGCCTGGCCTTGAGACCGGCT No data
Right 1185483939 X:468219-468241 CTCACCACATGTGAGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185483939 Original CRISPR CTCACCACATGTGAGCAGCC AGG Intergenic
No off target data available for this crispr