ID: 1185487968

View in Genome Browser
Species Human (GRCh38)
Location X:497597-497619
Sequence GCCTCGGAGAGACTACGGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185487968_1185487973 18 Left 1185487968 X:497597-497619 CCGTACCGTAGTCTCTCCGAGGC No data
Right 1185487973 X:497638-497660 ATTTCATCTTCCGTGAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185487968 Original CRISPR GCCTCGGAGAGACTACGGTA CGG (reversed) Intergenic
No off target data available for this crispr