ID: 1185488055

View in Genome Browser
Species Human (GRCh38)
Location X:498143-498165
Sequence GCTATTAGGTCCCAGGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185488046_1185488055 21 Left 1185488046 X:498099-498121 CCCAGTCCCAGGATGGAGCCGGA No data
Right 1185488055 X:498143-498165 GCTATTAGGTCCCAGGATGCAGG No data
1185488048_1185488055 15 Left 1185488048 X:498105-498127 CCCAGGATGGAGCCGGATTCAAG No data
Right 1185488055 X:498143-498165 GCTATTAGGTCCCAGGATGCAGG No data
1185488049_1185488055 14 Left 1185488049 X:498106-498128 CCAGGATGGAGCCGGATTCAAGC No data
Right 1185488055 X:498143-498165 GCTATTAGGTCCCAGGATGCAGG No data
1185488043_1185488055 30 Left 1185488043 X:498090-498112 CCATTAGGTCCCAGTCCCAGGAT No data
Right 1185488055 X:498143-498165 GCTATTAGGTCCCAGGATGCAGG No data
1185488047_1185488055 20 Left 1185488047 X:498100-498122 CCAGTCCCAGGATGGAGCCGGAT No data
Right 1185488055 X:498143-498165 GCTATTAGGTCCCAGGATGCAGG No data
1185488052_1185488055 -8 Left 1185488052 X:498128-498150 CCTGCTATGTAGATGGCTATTAG No data
Right 1185488055 X:498143-498165 GCTATTAGGTCCCAGGATGCAGG No data
1185488050_1185488055 3 Left 1185488050 X:498117-498139 CCGGATTCAAGCCTGCTATGTAG No data
Right 1185488055 X:498143-498165 GCTATTAGGTCCCAGGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185488055 Original CRISPR GCTATTAGGTCCCAGGATGC AGG Intergenic
No off target data available for this crispr