ID: 1185488104

View in Genome Browser
Species Human (GRCh38)
Location X:498432-498454
Sequence AGCTACATCCCAGGACCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185488104_1185488109 23 Left 1185488104 X:498432-498454 CCATTAGGTCCTGGGATGTAGCT No data
Right 1185488109 X:498478-498500 GGCCATTAGGTCCCAGTCCCAGG No data
1185488104_1185488108 10 Left 1185488104 X:498432-498454 CCATTAGGTCCTGGGATGTAGCT No data
Right 1185488108 X:498465-498487 CTGCTGTGTAGACGGCCATTAGG No data
1185488104_1185488106 2 Left 1185488104 X:498432-498454 CCATTAGGTCCTGGGATGTAGCT No data
Right 1185488106 X:498457-498479 ATCCGAGTCTGCTGTGTAGACGG No data
1185488104_1185488111 27 Left 1185488104 X:498432-498454 CCATTAGGTCCTGGGATGTAGCT No data
Right 1185488111 X:498482-498504 ATTAGGTCCCAGTCCCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185488104 Original CRISPR AGCTACATCCCAGGACCTAA TGG (reversed) Intergenic