ID: 1185488105

View in Genome Browser
Species Human (GRCh38)
Location X:498441-498463
Sequence CTCGGATGCAGCTACATCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185488105_1185488108 1 Left 1185488105 X:498441-498463 CCTGGGATGTAGCTGCATCCGAG No data
Right 1185488108 X:498465-498487 CTGCTGTGTAGACGGCCATTAGG No data
1185488105_1185488109 14 Left 1185488105 X:498441-498463 CCTGGGATGTAGCTGCATCCGAG No data
Right 1185488109 X:498478-498500 GGCCATTAGGTCCCAGTCCCAGG No data
1185488105_1185488112 24 Left 1185488105 X:498441-498463 CCTGGGATGTAGCTGCATCCGAG No data
Right 1185488112 X:498488-498510 TCCCAGTCCCAGGATGGAGCTGG No data
1185488105_1185488111 18 Left 1185488105 X:498441-498463 CCTGGGATGTAGCTGCATCCGAG No data
Right 1185488111 X:498482-498504 ATTAGGTCCCAGTCCCAGGATGG No data
1185488105_1185488106 -7 Left 1185488105 X:498441-498463 CCTGGGATGTAGCTGCATCCGAG No data
Right 1185488106 X:498457-498479 ATCCGAGTCTGCTGTGTAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185488105 Original CRISPR CTCGGATGCAGCTACATCCC AGG (reversed) Intergenic