ID: 1185488107

View in Genome Browser
Species Human (GRCh38)
Location X:498459-498481
Sequence GGCCGTCTACACAGCAGACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185488107_1185488112 6 Left 1185488107 X:498459-498481 CCGAGTCTGCTGTGTAGACGGCC No data
Right 1185488112 X:498488-498510 TCCCAGTCCCAGGATGGAGCTGG No data
1185488107_1185488109 -4 Left 1185488107 X:498459-498481 CCGAGTCTGCTGTGTAGACGGCC No data
Right 1185488109 X:498478-498500 GGCCATTAGGTCCCAGTCCCAGG No data
1185488107_1185488117 29 Left 1185488107 X:498459-498481 CCGAGTCTGCTGTGTAGACGGCC No data
Right 1185488117 X:498511-498533 AGTTGAGCCTGCTATGTAGATGG No data
1185488107_1185488111 0 Left 1185488107 X:498459-498481 CCGAGTCTGCTGTGTAGACGGCC No data
Right 1185488111 X:498482-498504 ATTAGGTCCCAGTCCCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185488107 Original CRISPR GGCCGTCTACACAGCAGACT CGG (reversed) Intergenic