ID: 1185488109

View in Genome Browser
Species Human (GRCh38)
Location X:498478-498500
Sequence GGCCATTAGGTCCCAGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185488107_1185488109 -4 Left 1185488107 X:498459-498481 CCGAGTCTGCTGTGTAGACGGCC No data
Right 1185488109 X:498478-498500 GGCCATTAGGTCCCAGTCCCAGG No data
1185488104_1185488109 23 Left 1185488104 X:498432-498454 CCATTAGGTCCTGGGATGTAGCT No data
Right 1185488109 X:498478-498500 GGCCATTAGGTCCCAGTCCCAGG No data
1185488105_1185488109 14 Left 1185488105 X:498441-498463 CCTGGGATGTAGCTGCATCCGAG No data
Right 1185488109 X:498478-498500 GGCCATTAGGTCCCAGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185488109 Original CRISPR GGCCATTAGGTCCCAGTCCC AGG Intergenic