ID: 1185488110

View in Genome Browser
Species Human (GRCh38)
Location X:498480-498502
Sequence ATCCTGGGACTGGGACCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185488110_1185488120 23 Left 1185488110 X:498480-498502 CCATTAGGTCCCAGTCCCAGGAT No data
Right 1185488120 X:498526-498548 GTAGATGGCTATTAGGTCCCAGG No data
1185488110_1185488121 30 Left 1185488110 X:498480-498502 CCATTAGGTCCCAGTCCCAGGAT No data
Right 1185488121 X:498533-498555 GCTATTAGGTCCCAGGACGCAGG No data
1185488110_1185488117 8 Left 1185488110 X:498480-498502 CCATTAGGTCCCAGTCCCAGGAT No data
Right 1185488117 X:498511-498533 AGTTGAGCCTGCTATGTAGATGG No data
1185488110_1185488119 16 Left 1185488110 X:498480-498502 CCATTAGGTCCCAGTCCCAGGAT No data
Right 1185488119 X:498519-498541 CTGCTATGTAGATGGCTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185488110 Original CRISPR ATCCTGGGACTGGGACCTAA TGG (reversed) Intergenic
No off target data available for this crispr