ID: 1185488112

View in Genome Browser
Species Human (GRCh38)
Location X:498488-498510
Sequence TCCCAGTCCCAGGATGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185488105_1185488112 24 Left 1185488105 X:498441-498463 CCTGGGATGTAGCTGCATCCGAG No data
Right 1185488112 X:498488-498510 TCCCAGTCCCAGGATGGAGCTGG No data
1185488107_1185488112 6 Left 1185488107 X:498459-498481 CCGAGTCTGCTGTGTAGACGGCC No data
Right 1185488112 X:498488-498510 TCCCAGTCCCAGGATGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185488112 Original CRISPR TCCCAGTCCCAGGATGGAGC TGG Intergenic