ID: 1185488115

View in Genome Browser
Species Human (GRCh38)
Location X:498495-498517
Sequence CTCAACTCCAGCTCCATCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185488115_1185488121 15 Left 1185488115 X:498495-498517 CCCAGGATGGAGCTGGAGTTGAG No data
Right 1185488121 X:498533-498555 GCTATTAGGTCCCAGGACGCAGG No data
1185488115_1185488119 1 Left 1185488115 X:498495-498517 CCCAGGATGGAGCTGGAGTTGAG No data
Right 1185488119 X:498519-498541 CTGCTATGTAGATGGCTATTAGG No data
1185488115_1185488122 18 Left 1185488115 X:498495-498517 CCCAGGATGGAGCTGGAGTTGAG No data
Right 1185488122 X:498536-498558 ATTAGGTCCCAGGACGCAGGTGG No data
1185488115_1185488117 -7 Left 1185488115 X:498495-498517 CCCAGGATGGAGCTGGAGTTGAG No data
Right 1185488117 X:498511-498533 AGTTGAGCCTGCTATGTAGATGG No data
1185488115_1185488120 8 Left 1185488115 X:498495-498517 CCCAGGATGGAGCTGGAGTTGAG No data
Right 1185488120 X:498526-498548 GTAGATGGCTATTAGGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185488115 Original CRISPR CTCAACTCCAGCTCCATCCT GGG (reversed) Intergenic
No off target data available for this crispr