ID: 1185488118

View in Genome Browser
Species Human (GRCh38)
Location X:498518-498540
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185488118_1185488127 26 Left 1185488118 X:498518-498540 CCTGCTATGTAGATGGCTATTAG No data
Right 1185488127 X:498567-498589 CTGCTGCATAGATGGCCATTAGG No data
1185488118_1185488125 18 Left 1185488118 X:498518-498540 CCTGCTATGTAGATGGCTATTAG No data
Right 1185488125 X:498559-498581 ATCCGAGTCTGCTGCATAGATGG No data
1185488118_1185488121 -8 Left 1185488118 X:498518-498540 CCTGCTATGTAGATGGCTATTAG No data
Right 1185488121 X:498533-498555 GCTATTAGGTCCCAGGACGCAGG No data
1185488118_1185488122 -5 Left 1185488118 X:498518-498540 CCTGCTATGTAGATGGCTATTAG No data
Right 1185488122 X:498536-498558 ATTAGGTCCCAGGACGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185488118 Original CRISPR CTAATAGCCATCTACATAGC AGG (reversed) Intergenic