ID: 1185488120

View in Genome Browser
Species Human (GRCh38)
Location X:498526-498548
Sequence GTAGATGGCTATTAGGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185488114_1185488120 13 Left 1185488114 X:498490-498512 CCAGTCCCAGGATGGAGCTGGAG No data
Right 1185488120 X:498526-498548 GTAGATGGCTATTAGGTCCCAGG No data
1185488115_1185488120 8 Left 1185488115 X:498495-498517 CCCAGGATGGAGCTGGAGTTGAG No data
Right 1185488120 X:498526-498548 GTAGATGGCTATTAGGTCCCAGG No data
1185488110_1185488120 23 Left 1185488110 X:498480-498502 CCATTAGGTCCCAGTCCCAGGAT No data
Right 1185488120 X:498526-498548 GTAGATGGCTATTAGGTCCCAGG No data
1185488113_1185488120 14 Left 1185488113 X:498489-498511 CCCAGTCCCAGGATGGAGCTGGA No data
Right 1185488120 X:498526-498548 GTAGATGGCTATTAGGTCCCAGG No data
1185488116_1185488120 7 Left 1185488116 X:498496-498518 CCAGGATGGAGCTGGAGTTGAGC No data
Right 1185488120 X:498526-498548 GTAGATGGCTATTAGGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185488120 Original CRISPR GTAGATGGCTATTAGGTCCC AGG Intergenic