ID: 1185488598

View in Genome Browser
Species Human (GRCh38)
Location X:501346-501368
Sequence GCCATTAGGTCCCGGGACGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185488591_1185488598 24 Left 1185488591 X:501299-501321 CCATTAGGTCCTGAGACGGAGCT No data
Right 1185488598 X:501346-501368 GCCATTAGGTCCCGGGACGCAGG No data
1185488593_1185488598 15 Left 1185488593 X:501308-501330 CCTGAGACGGAGCTGGATTCAAG No data
Right 1185488598 X:501346-501368 GCCATTAGGTCCCGGGACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185488598 Original CRISPR GCCATTAGGTCCCGGGACGC AGG Intergenic
No off target data available for this crispr