ID: 1185488635

View in Genome Browser
Species Human (GRCh38)
Location X:501560-501582
Sequence TCCAGCTCCATCCTGGGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185488635_1185488639 -1 Left 1185488635 X:501560-501582 CCCAGTCCCAGGATGGAGCTGGA No data
Right 1185488639 X:501582-501604 AGTCAAGCCTGCTGTGTAGACGG No data
1185488635_1185488642 14 Left 1185488635 X:501560-501582 CCCAGTCCCAGGATGGAGCTGGA No data
Right 1185488642 X:501597-501619 GTAGACGGCCATTAGGTCCCAGG No data
1185488635_1185488643 21 Left 1185488635 X:501560-501582 CCCAGTCCCAGGATGGAGCTGGA No data
Right 1185488643 X:501604-501626 GCCATTAGGTCCCAGGATGCAGG No data
1185488635_1185488641 7 Left 1185488635 X:501560-501582 CCCAGTCCCAGGATGGAGCTGGA No data
Right 1185488641 X:501590-501612 CTGCTGTGTAGACGGCCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185488635 Original CRISPR TCCAGCTCCATCCTGGGACT GGG (reversed) Intergenic
No off target data available for this crispr