ID: 1185488640

View in Genome Browser
Species Human (GRCh38)
Location X:501589-501611
Sequence CTAATGGCCGTCTACACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185488640_1185488643 -8 Left 1185488640 X:501589-501611 CCTGCTGTGTAGACGGCCATTAG No data
Right 1185488643 X:501604-501626 GCCATTAGGTCCCAGGATGCAGG No data
1185488640_1185488647 18 Left 1185488640 X:501589-501611 CCTGCTGTGTAGACGGCCATTAG No data
Right 1185488647 X:501630-501652 ATCCTAGTCTGCTGCATAGACGG No data
1185488640_1185488649 26 Left 1185488640 X:501589-501611 CCTGCTGTGTAGACGGCCATTAG No data
Right 1185488649 X:501638-501660 CTGCTGCATAGACGGCCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185488640 Original CRISPR CTAATGGCCGTCTACACAGC AGG (reversed) Intergenic
No off target data available for this crispr