ID: 1185488643

View in Genome Browser
Species Human (GRCh38)
Location X:501604-501626
Sequence GCCATTAGGTCCCAGGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185488640_1185488643 -8 Left 1185488640 X:501589-501611 CCTGCTGTGTAGACGGCCATTAG No data
Right 1185488643 X:501604-501626 GCCATTAGGTCCCAGGATGCAGG No data
1185488635_1185488643 21 Left 1185488635 X:501560-501582 CCCAGTCCCAGGATGGAGCTGGA No data
Right 1185488643 X:501604-501626 GCCATTAGGTCCCAGGATGCAGG No data
1185488637_1185488643 15 Left 1185488637 X:501566-501588 CCCAGGATGGAGCTGGAGTCAAG No data
Right 1185488643 X:501604-501626 GCCATTAGGTCCCAGGATGCAGG No data
1185488636_1185488643 20 Left 1185488636 X:501561-501583 CCAGTCCCAGGATGGAGCTGGAG No data
Right 1185488643 X:501604-501626 GCCATTAGGTCCCAGGATGCAGG No data
1185488638_1185488643 14 Left 1185488638 X:501567-501589 CCAGGATGGAGCTGGAGTCAAGC No data
Right 1185488643 X:501604-501626 GCCATTAGGTCCCAGGATGCAGG No data
1185488632_1185488643 30 Left 1185488632 X:501551-501573 CCATTAGGTCCCAGTCCCAGGAT No data
Right 1185488643 X:501604-501626 GCCATTAGGTCCCAGGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185488643 Original CRISPR GCCATTAGGTCCCAGGATGC AGG Intergenic
No off target data available for this crispr