ID: 1185500249

View in Genome Browser
Species Human (GRCh38)
Location X:591397-591419
Sequence CTTTTTCTCTGCACGGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185500245_1185500249 5 Left 1185500245 X:591369-591391 CCTTTTGTTTGGCAGCCGGACGG No data
Right 1185500249 X:591397-591419 CTTTTTCTCTGCACGGAGTCTGG No data
1185500247_1185500249 -10 Left 1185500247 X:591384-591406 CCGGACGGTGCAGCTTTTTCTCT No data
Right 1185500249 X:591397-591419 CTTTTTCTCTGCACGGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185500249 Original CRISPR CTTTTTCTCTGCACGGAGTC TGG Intergenic
No off target data available for this crispr