ID: 1185503190

View in Genome Browser
Species Human (GRCh38)
Location X:614347-614369
Sequence CACCTGGGACCCCTGTAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185503184_1185503190 -9 Left 1185503184 X:614333-614355 CCTTCTCCTGCCCCCACCTGGGA No data
Right 1185503190 X:614347-614369 CACCTGGGACCCCTGTAGCAAGG No data
1185503180_1185503190 21 Left 1185503180 X:614303-614325 CCTGGCTTTGCTCTTGGAGGTGC No data
Right 1185503190 X:614347-614369 CACCTGGGACCCCTGTAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185503190 Original CRISPR CACCTGGGACCCCTGTAGCA AGG Intergenic
No off target data available for this crispr