ID: 1185503345

View in Genome Browser
Species Human (GRCh38)
Location X:615385-615407
Sequence CTGGTGTCTTTGGGGAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185503345_1185503351 6 Left 1185503345 X:615385-615407 CCCTTTTTCCCCAAAGACACCAG No data
Right 1185503351 X:615414-615436 TAGAATCCATCTTCCCCAACAGG No data
1185503345_1185503352 7 Left 1185503345 X:615385-615407 CCCTTTTTCCCCAAAGACACCAG No data
Right 1185503352 X:615415-615437 AGAATCCATCTTCCCCAACAGGG No data
1185503345_1185503353 8 Left 1185503345 X:615385-615407 CCCTTTTTCCCCAAAGACACCAG No data
Right 1185503353 X:615416-615438 GAATCCATCTTCCCCAACAGGGG No data
1185503345_1185503358 21 Left 1185503345 X:615385-615407 CCCTTTTTCCCCAAAGACACCAG No data
Right 1185503358 X:615429-615451 CCAACAGGGGTTCTAGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185503345 Original CRISPR CTGGTGTCTTTGGGGAAAAA GGG (reversed) Intergenic
No off target data available for this crispr