ID: 1185503353

View in Genome Browser
Species Human (GRCh38)
Location X:615416-615438
Sequence GAATCCATCTTCCCCAACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185503345_1185503353 8 Left 1185503345 X:615385-615407 CCCTTTTTCCCCAAAGACACCAG No data
Right 1185503353 X:615416-615438 GAATCCATCTTCCCCAACAGGGG No data
1185503348_1185503353 -1 Left 1185503348 X:615394-615416 CCCAAAGACACCAGAAAAACTAG No data
Right 1185503353 X:615416-615438 GAATCCATCTTCCCCAACAGGGG No data
1185503346_1185503353 7 Left 1185503346 X:615386-615408 CCTTTTTCCCCAAAGACACCAGA No data
Right 1185503353 X:615416-615438 GAATCCATCTTCCCCAACAGGGG No data
1185503349_1185503353 -2 Left 1185503349 X:615395-615417 CCAAAGACACCAGAAAAACTAGA No data
Right 1185503353 X:615416-615438 GAATCCATCTTCCCCAACAGGGG No data
1185503347_1185503353 0 Left 1185503347 X:615393-615415 CCCCAAAGACACCAGAAAAACTA No data
Right 1185503353 X:615416-615438 GAATCCATCTTCCCCAACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185503353 Original CRISPR GAATCCATCTTCCCCAACAG GGG Intergenic
No off target data available for this crispr