ID: 1185503358

View in Genome Browser
Species Human (GRCh38)
Location X:615429-615451
Sequence CCAACAGGGGTTCTAGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185503349_1185503358 11 Left 1185503349 X:615395-615417 CCAAAGACACCAGAAAAACTAGA No data
Right 1185503358 X:615429-615451 CCAACAGGGGTTCTAGAAACAGG No data
1185503345_1185503358 21 Left 1185503345 X:615385-615407 CCCTTTTTCCCCAAAGACACCAG No data
Right 1185503358 X:615429-615451 CCAACAGGGGTTCTAGAAACAGG No data
1185503346_1185503358 20 Left 1185503346 X:615386-615408 CCTTTTTCCCCAAAGACACCAGA No data
Right 1185503358 X:615429-615451 CCAACAGGGGTTCTAGAAACAGG No data
1185503348_1185503358 12 Left 1185503348 X:615394-615416 CCCAAAGACACCAGAAAAACTAG No data
Right 1185503358 X:615429-615451 CCAACAGGGGTTCTAGAAACAGG No data
1185503350_1185503358 2 Left 1185503350 X:615404-615426 CCAGAAAAACTAGAATCCATCTT No data
Right 1185503358 X:615429-615451 CCAACAGGGGTTCTAGAAACAGG No data
1185503347_1185503358 13 Left 1185503347 X:615393-615415 CCCCAAAGACACCAGAAAAACTA No data
Right 1185503358 X:615429-615451 CCAACAGGGGTTCTAGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185503358 Original CRISPR CCAACAGGGGTTCTAGAAAC AGG Intergenic
No off target data available for this crispr