ID: 1185504707

View in Genome Browser
Species Human (GRCh38)
Location X:623893-623915
Sequence CTGGAGACGCAGGCGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185504707_1185504717 5 Left 1185504707 X:623893-623915 CCCAGCCCCGCCTGCGTCTCCAG No data
Right 1185504717 X:623921-623943 AAATAAGAAGCAAATCTTGCTGG No data
1185504707_1185504718 6 Left 1185504707 X:623893-623915 CCCAGCCCCGCCTGCGTCTCCAG No data
Right 1185504718 X:623922-623944 AATAAGAAGCAAATCTTGCTGGG No data
1185504707_1185504720 24 Left 1185504707 X:623893-623915 CCCAGCCCCGCCTGCGTCTCCAG No data
Right 1185504720 X:623940-623962 CTGGGACCGAGTTCAGGTCGAGG No data
1185504707_1185504719 18 Left 1185504707 X:623893-623915 CCCAGCCCCGCCTGCGTCTCCAG No data
Right 1185504719 X:623934-623956 ATCTTGCTGGGACCGAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185504707 Original CRISPR CTGGAGACGCAGGCGGGGCT GGG (reversed) Intergenic
No off target data available for this crispr