ID: 1185510425

View in Genome Browser
Species Human (GRCh38)
Location X:660049-660071
Sequence AAGAAGAAGAAGAAGAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5205
Summary {0: 13, 1: 55, 2: 313, 3: 900, 4: 3924}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185510425_1185510428 17 Left 1185510425 X:660049-660071 CCAGCCTTCTTCTTCTTCTTCTT 0: 13
1: 55
2: 313
3: 900
4: 3924
Right 1185510428 X:660089-660111 GGAGTTTCACTCTGTTGCCCAGG 0: 380
1: 9829
2: 42674
3: 133224
4: 289357
1185510425_1185510427 -4 Left 1185510425 X:660049-660071 CCAGCCTTCTTCTTCTTCTTCTT 0: 13
1: 55
2: 313
3: 900
4: 3924
Right 1185510427 X:660068-660090 TCTTTTTTTTTTTTTTAAGATGG 0: 161
1: 7143
2: 99044
3: 76586
4: 105270
1185510425_1185510429 21 Left 1185510425 X:660049-660071 CCAGCCTTCTTCTTCTTCTTCTT 0: 13
1: 55
2: 313
3: 900
4: 3924
Right 1185510429 X:660093-660115 TTTCACTCTGTTGCCCAGGCTGG 0: 1235
1: 28092
2: 108625
3: 308144
4: 392602

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185510425 Original CRISPR AAGAAGAAGAAGAAGAAGGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr