ID: 1185513607

View in Genome Browser
Species Human (GRCh38)
Location X:681228-681250
Sequence GAGCCGGCTGCACAGTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185513598_1185513607 16 Left 1185513598 X:681189-681211 CCACTGCAGGCACGTTTCTTCCC No data
Right 1185513607 X:681228-681250 GAGCCGGCTGCACAGTTTGTGGG No data
1185513605_1185513607 -10 Left 1185513605 X:681215-681237 CCGGTGGATGGCAGAGCCGGCTG No data
Right 1185513607 X:681228-681250 GAGCCGGCTGCACAGTTTGTGGG No data
1185513602_1185513607 -4 Left 1185513602 X:681209-681231 CCCATGCCGGTGGATGGCAGAGC No data
Right 1185513607 X:681228-681250 GAGCCGGCTGCACAGTTTGTGGG No data
1185513603_1185513607 -5 Left 1185513603 X:681210-681232 CCATGCCGGTGGATGGCAGAGCC No data
Right 1185513607 X:681228-681250 GAGCCGGCTGCACAGTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185513607 Original CRISPR GAGCCGGCTGCACAGTTTGT GGG Intergenic
No off target data available for this crispr