ID: 1185516359

View in Genome Browser
Species Human (GRCh38)
Location X:701865-701887
Sequence GTCTGCACCATGGTTGAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185516359_1185516368 28 Left 1185516359 X:701865-701887 CCCGGCTCAACCATGGTGCAGAC No data
Right 1185516368 X:701916-701938 AGGAGAACATCCCACTCTGTGGG No data
1185516359_1185516367 27 Left 1185516359 X:701865-701887 CCCGGCTCAACCATGGTGCAGAC No data
Right 1185516367 X:701915-701937 GAGGAGAACATCCCACTCTGTGG No data
1185516359_1185516365 8 Left 1185516359 X:701865-701887 CCCGGCTCAACCATGGTGCAGAC No data
Right 1185516365 X:701896-701918 AGCTACGTTCCTGCTATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185516359 Original CRISPR GTCTGCACCATGGTTGAGCC GGG (reversed) Intergenic
No off target data available for this crispr